Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mgg
    Member
    • Nov 2011
    • 12

    #1

    FastQC,kmer content, per base sequence content: is this good enough

    Hi,

    I'd appreciate some advice on processing some Illumina libraries

    Initial FastQC runs showed the data as not great. I've used cutadapt to trim off adapters and FastQC shows improvements to all libraries.

    One remains of concern, because it still retains kmer and other issues (I've attached files for kmer content & per base sequence content for both the original and the processed data)

    My question is simple: is this good enough? (my next step is assembly with velvet) Does this data need some further processing before Velvet? If so, with what? I've considered trimming off the first 10nuc to remove the anomalous per_base_sequence_content trace, but that would do little for the persistent kmers.

    If this were your data, what would you do before velvet assembly?

    thanks
    mgg

    for the record my cutadapt commands are below

    PHP Code:
    # trim reads/2
    cutadapt -b AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --minimum-length=10  --overlap=--quality-base=64 --quality-cutoff=--match-read-wildcards infile_2.fq -o processed/outfile_2.fq --wildcard-file=processed/outfile_2.fq.wildcard

    # trim reads/1
    cutadapt -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --minimum-length=10  --overlap=--quality-base=64 --quality-cutoff=--match-read-wildcards infile_1.fq -o processed/outfile_1.fq --wildcard-file=processed/outfile_1.fq.wildcard 
    Attached Files
  • minoru_harvest
    Junior Member
    • Aug 2012
    • 5

    #2
    yeah. i got the same question
    i have a very similar graph with your prosessed-per-base-sequencecontent

    Comment

    • Wallysb01
      Senior Member
      • Feb 2011
      • 286

      #3
      Looks like you have some base pair bias issues going on from bases 1-10 in your reads. You should trim those off.

      Comment

      • Jane M
        Senior Member
        • Aug 2011
        • 239

        #4
        Hello everybody,

        I come back to this topic which fits well to my interrogation: I would like your point of view on my RNA-Seq data (paired-ends, 100bp) generated by an Illumina HiSeq 2000 machine.
        I attached the "Per Base sequence Quality" and "Kmer Content" for 3 examples. In the first one, the library was prepared using polyA method. The 2 next examples were performed by ribodepletion. I would like to know if my data are "good enough" despite these 2 last profiles and if there is an explanation for this increase of A/T sequence along the read?

        I have the feeling from these examples and some others that the "Kmer Content profile" depends on the library preparation (ribodepletion vs polyA), the run (samples from a same run show a similar profile) and the sample itself (I observed similar profiles for a same sample ran on 2 different runs). Is this true?

        Thank you,
        Jane

        Comment

        • fahmida
          Member
          • Aug 2010
          • 54

          #5
          Originally posted by mgg View Post
          Hi,

          I'd appreciate some advice on processing some Illumina libraries

          Initial FastQC runs showed the data as not great. I've used cutadapt to trim off adapters and FastQC shows improvements to all libraries.

          One remains of concern, because it still retains kmer and other issues (I've attached files for kmer content & per base sequence content for both the original and the processed data)

          My question is simple: is this good enough? (my next step is assembly with velvet) Does this data need some further processing before Velvet? If so, with what? I've considered trimming off the first 10nuc to remove the anomalous per_base_sequence_content trace, but that would do little for the persistent kmers.

          If this were your data, what would you do before velvet assembly?

          thanks
          mgg

          for the record my cutadapt commands are below

          PHP Code:
          # trim reads/2
          cutadapt -b AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --minimum-length=10  --overlap=--quality-base=64 --quality-cutoff=--match-read-wildcards infile_2.fq -o processed/outfile_2.fq --wildcard-file=processed/outfile_2.fq.wildcard

          # trim reads/1
          cutadapt -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --minimum-length=10  --overlap=--quality-base=64 --quality-cutoff=--match-read-wildcards infile_1.fq -o processed/outfile_1.fq --wildcard-file=processed/outfile_1.fq.wildcard 
          Are these reads from mate pair libraries? You may also want to check the read duplication levels in that case.

          Comment

          • Jane M
            Senior Member
            • Aug 2011
            • 239

            #6
            I come back to my previous question because I still have doubts concerning the quality of my data. Any feedback would be appreciated

            Comment

            • Wallysb01
              Senior Member
              • Feb 2011
              • 286

              #7
              I didn't see the attachment. But from what you describe, it sounds ok.

              Comment

              • Jane M
                Senior Member
                • Aug 2011
                • 239

                #8
                Originally posted by Wallysb01 View Post
                I didn't see the attachment. But from what you describe, it sounds ok.
                Oups, I forgot to attach the file!
                Attached Files

                Comment

                • Jane M
                  Senior Member
                  • Aug 2011
                  • 239

                  #9
                  Originally posted by Jane M View Post
                  Oups, I forgot to attach the file!
                  Any comment with the attachment?

                  Comment

                  • Wallysb01
                    Senior Member
                    • Feb 2011
                    • 286

                    #10
                    Looks good enough for mapping. Might want to see if you have some adapter contamination in the first one. I've often found weird suden spikes of particular kmers are the adapters.

                    Comment

                    • Jane M
                      Senior Member
                      • Aug 2011
                      • 239

                      #11
                      Thank you Wallysb01.

                      Isn't it suprising to see an increase of AAAAA and TTTTT all along the read? It shoulb be constant, right?, like in the first case.
                      Why is there such a difference between polyA and ribodepletion?

                      Do all the "normal/good profiles" of these 2 methods always differ?

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        Today, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Today, 02:55 AM
                      0 responses
                      6 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      11 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-23-2026, 11:41 AM
                      0 responses
                      12 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-20-2026, 11:10 AM
                      0 responses
                      24 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...