Please, examine my fastq file. Help me, one more time!

[sejong]

I ran - ELAND_standalone.pl with fasta to fastq converted file.

like this...

perl ELAND_standalone.pl -if /data/clip/fus/lane1.fa -it fastq -eg /data/Genome/ELAND/mm9/

but.. I got an error message like this:

Could not identify index of the following line: EAS41_4_1_200_725_616_963
Please check your files.

My fastq file contains.......

@EAS41_4_1_200_725_616_963
CGTATGCCGTCTTCTGCTTGTCGTATGCCGTCTTCT
+
::::::::::::::::::::::::::::::::::::
@EAS41_4_1_200_232_69_883
..................................................................................

I must finish ELAND_standalone program with this file by weekend. (or I will die)

I'm trying to run this program with another fastq file, but could not identify the first line of files.

Please, help me~~

[ljxue]

why not try "fq_all2std.pl" in MAQ

[kmcarr]

Sejong,

The format of your read ID tags is incorrect, Eland can not interpret them. The required format looks like this:

@HWI-EAS216:1:2:1:2017#0/1

It represents:

@<machine_id>:<lane>:<tile>:<x_coord>:<y_coord>#<index>/<read_#>

The underscores ( _ ) should be replaced with colons ( : ) in the. Also add "#0/1" to the end of each name. The #0 indicates that no multiplex indexing was used. the /1 means that this is either that this read is from a single end run or it is read 1 from a paired read run.

There also seems to be too many numbers in your read names. There should be four numbers following the machine id which identify the lane, tile, x and y coordinates of the read. Your read names have six numbers. Are they from an earlier version of the pipeline?

[sejong]

Thanks ~



I solved problem finally!

thanks ~~