COMMAND LINE:	skewer -x AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG -y AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGAT -t 8 SRR330569_1.fastq SRR330569_2.fastq
Input file:	SRR330569_1.fastq
Paired file:	SRR330569_2.fastq
trimmed:	SRR330569_1.trimmed-Q0L18-pair1.fastq, SRR330569_1.trimmed-Q0L18-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGAT
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ (auto detected)
-- number of concurrent threads (-t):	8
Tue Feb 25 11:32:32 2014 >> started

Tue Feb 25 11:34:14 2014 >> done (102.664s)
27005344 read pairs processed; of these:
    1058 ( 0.00%) short read pairs filtered out after trimming by size control
     924 ( 0.00%) empty read pairs filtered out after trimming by size control
27003362 (99.99%) read pairs available; of these:
11959533 (44.29%) trimmed read pairs available after processing
15043829 (55.71%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	     116	  0.00%
 19	   11780	  0.04%
 20	     447	  0.00%
 21	     209	  0.00%
 22	     287	  0.00%
 23	     203	  0.00%
 24	     281	  0.00%
 25	     462	  0.00%
 26	     772	  0.00%
 27	    2371	  0.01%
 28	    1778	  0.01%
 29	    2318	  0.01%
 30	    2954	  0.01%
 31	    3831	  0.01%
 32	    3801	  0.01%
 33	    3945	  0.01%
 34	    4916	  0.02%
 35	    6693	  0.02%
 36	    8381	  0.03%
 37	   10210	  0.04%
 38	   11703	  0.04%
 39	   13772	  0.05%
 40	   15256	  0.06%
 41	   17228	  0.06%
 42	   18662	  0.07%
 43	   20341	  0.08%
 44	   22273	  0.08%
 45	   24510	  0.09%
 46	   27515	  0.10%
 47	   30597	  0.11%
 48	   32814	  0.12%
 49	   35568	  0.13%
 50	   39412	  0.15%
 51	   44386	  0.16%
 52	   46936	  0.17%
 53	   50169	  0.19%
 54	   53504	  0.20%
 55	   57380	  0.21%
 56	   63113	  0.23%
 57	   67669	  0.25%
 58	   74728	  0.28%
 59	   78066	  0.29%
 60	   85139	  0.32%
 61	   92738	  0.34%
 62	   99827	  0.37%
 63	  108350	  0.40%
 64	  114629	  0.42%
 65	  122031	  0.45%
 66	  130659	  0.48%
 67	  141540	  0.52%
 68	  147373	  0.55%
 69	  161523	  0.60%
 70	  167153	  0.62%
 71	  183922	  0.68%
 72	  199042	  0.74%
 73	  212157	  0.79%
 74	  211781	  0.78%
 75	  219951	  0.81%
 76	  225731	  0.84%
 77	  245783	  0.91%
 78	  259922	  0.96%
 79	  274157	  1.02%
 80	  280639	  1.04%
 81	  290088	  1.07%
 82	  295182	  1.09%
 83	  303355	  1.12%
 84	  317816	  1.18%
 85	  329503	  1.22%
 86	  343732	  1.27%
 87	  339552	  1.26%
 88	  351034	  1.30%
 89	  362213	  1.34%
 90	  360482	  1.33%
 91	  369942	  1.37%
 92	  392152	  1.45%
 93	  412609	  1.53%
 94	  398153	  1.47%
 95	  439008	  1.63%
 96	  407245	  1.51%
 97	  415674	  1.54%
 98	  405396	  1.50%
 99	  407933	  1.51%
100	  423060	  1.57%
101	15043829	 55.71%