RepeatMasker error: line in unrecognized format

[ashleyrosek]

Hey everyone,

I'm currently trying to run RepeatMasker on a RepeatScout generated library in FASTA form, and I keep getting the same error. RepeatMasker appears to be operating normally and the code I'm entering makes it run, but then it gives me output stating:

FastaDB::_cleanIndexAndCompact - WARNING: RepeatMasker encountered a line in an unrecognized format. The offending subsequence is "GGAAA\". The offending line is "AACAGAAATAAAACTATAACTGAAAATATATTTGTCTGACGTGGGAATTGAACTCACGGATAACGACTCGGTAAAGGAAA\". Sequence is being ignored.
FastaDB::_cleanIndexAndCompact - WARNING: RepeatMasker encountered a line in an unrecognized format. The offending subsequence is "ACCTG\". The offending line is "AATATCAGAAACCGATTTATTAATTAAAACATTTATTAAATATATTTATCATTATGGTATGCAAAGTATCAAAACACCTG\". Sequence is being ignored.
FastaDB::_cleanIndexAndCompact - WARNING: RepeatMasker encountered a line in an unrecognized format. The offending subsequence is "TTTCA\". The offending line is "CATAAATTAAATCGTTTACGTCATATTCCCTGAACTCGAGTATGCAAATAATAACGATATACTATAATATTTGTGTTTCA\". Sequence is being ignored.
FastaDB::_cleanIndexAndCompact - WARNING: RepeatMasker encountered a line in an unrecognized format. The offending subsequence is "ATTAC\". The offending line is "GAGTACACAAACTGTATATTATATTTGCAGGTGTTTTGAACTTGTGCATATTTACTTCTAGCAACAGTACCAACCATTAC\". Sequence is being ignored.

and just repeats that error message for the rest of my repeat library. I've tried it on several different repeat libraries, including ones that have been known to work in RepeatMasker in the past. Has anyone else ever run into this problem, or have any idea how to fix it? Thanks for your help!

[rhubley]

It looks like you have some strange characters at the end of these lines in your FASTA file. Open the file in a editor and double check the format of these sequences.