Hello All
I am trying to convert a Tophat SAM file to BAM and I get the warning message "The tag [ID] required for [PG] not present.". I have included it below. However then [sam_header_read2] sequences are loaded and the program runs successfully.
.
fyi...the first ten lines of the sam file:
I get a BAM output and would like to know if this would be a true binary representative of the original SAM file?
any thoughts or suggestions?
Siva
I am trying to convert a Tophat SAM file to BAM and I get the warning message "The tag [ID] required for [PG] not present.". I have included it below. However then [sam_header_read2] sequences are loaded and the program runs successfully.
Code:
./../../samtools-0.1.7a/samtools import ../../../ZmB73_AGPv1_genome.fasta.fai accepted_hits.sam accepted_hits_complete.bam The tag [ID] required for [PG] not present. [sam_header_read2] 11 sequences loaded
fyi...the first ten lines of the sam file:
Code:
@HD VN:1.0 SO:sorted @PG TopHat VN:1.0.13 CL:/share/apps/tophat-1.0.13/bin/tophat -o ./tophat_out_s8 -p 4 --solexa1.3-quals ./maize_genome_bwtind/ZmB73_AGPv1_genome_ind s_8_sequence.txt HWI-EAS313:8:102:1328:1633#0 16 chr1 421 3 42M * GATTTCCAGTACAGTCCTCGCTATTGCTGTGAAAAGTTGGCC @A??=A?B@@?BB@ABA>BA@BBB@:BABBBBBBB@BCBABB NM:i:0 HWI-EAS313:8:91:606:9#0 0 chr1 449 255 42M * 0 GTGAAAAGTTGGCCTCATATTCTTGGCTCCTCTTCAAAAAGA B@B@BB@B?@A@ABB@BBAB?@>=>??;<<=:?:07:4?8+< NM:i:0 HWI-EAS313:8:65:992:914#0 16 chr1 520 3 42M * TCTGGGCATCAGTAAAAAAATGGTGGTTCCAGTCATTACATC A?@5;@=?@>@>ABABBBBBBA>A:>BA@?AABBBBBACC@; NM:i:0 HWI-EAS313:8:10:620:686#0 0 chr1 559 3 42M * ATCAAGTCCACAGTTATTACTGAGAAAACCTGATCAGTTTAT BB?BBAAB6A@BC;AABBB@B@BA@@@AB@AB>A>A@;AAAB NM:i:0 HWI-EAS313:8:27:1782:1073#0 16 chr1 578 255 27M411N15M CTGAGAAAACCTGATCAGTTTATGCAGAATGTTTTGTTTTTC AA=@8@BB<A=A<?ABB@B@BBB=AA6BBB?BBBBBBBBBBB NM:i:0 XS:A:+ NS:i:0 HWI-EAS313:8:43:783:738#0 0 chr1 1052 255 42M * AAAACAACAGGAAAAATTCTGTGTCGTTCGCCTGAAATATTT :ABCBACBBCCBBBB?CB=A<>>ABB@B@@<BBB?BBBBBBB NM:i:0 HWI-EAS313:8:78:753:514#0 0 chr1 1052 255 42M * AAAACAACAGGAAAAATTCTGTGTCGTTCGCCTGAAATATTT AAA=CCAABACBC?BCA9<@@4B=<BB??C=?ABBBCBBB>7 NM:i:0 HWI-EAS313:8:17:949:19#0 0 chr1 1057 255 42M * AACAGGAAAAATTCTGTGTCGTTCGCCTGAAATATTTGCTTC ?CBCBCB=BBBCCBBB3?@@AB?AC8ABBBBBB@B@@@/B@9 NM:i:0
any thoughts or suggestions?
Siva
Comment