Extract the header of illumina sequence!

[sunnycqcn]

I have question about our DNA sequence data.
If the format of sequence data is
@HWI-ST1234:136:C5F6VACXX:6:1101:4121:2231 1:N:0:ACTTGA
TATGGGTTTCCACGGAGCACAGTGCCTAGTGCTCACTCCCCAGTTGTATCTTATTTTTCAGGTCAGCAGGTCGGGCCGGGAGTGTGACATGACGGAGCAGA
+
CCCFFFDDHHHHHJJGIJJJJJHIJJIJJHIJIJIJJJJJJIIIIJGIIBFHHFHJJJG>FHIJIGIIEHAHBBAB@BDBDD<?ACA>CDDDDDD5<BBD?.
I can extract the sequence identifier as @HWI-ST1234:136:C5F6VACXX:6:1101:4121:2231 1:N:0:ACTTGA using the code.
If the format of sequence data is
@HWI-ST1234:136:C5F6VACXX:6:1101:4295:2242 1:N:0:ACTTGA
AATACTTGTACGAGGGTGTTTTGCCACACCATATCTCATAAGGTGTGTTGGGTACATCTTTACTTGTCATTCTATTCAAAATATGTGTTGTTGTTTC
+
@@@ADD?DH8FH1CGG2A<F@FH?@?FC1DFGEDB9?BFHHIF?8?DBC=FB5@CDA;@)=.))..).;;B@B?@>>BDCCCCCD>B;?=5??<?CC
I can not extract the sequence identifier.

So I think the problem is the sequence data. The first symbol of second one is @. The first symbol of identifier also is @. So the code can not extract the correct sequencing identifier from our sequence data.
I want to extract the sequence identifier form my sequence data. The identifier format is @HWI-ST1234:136:C5F6VACXX:6:1101:4295:2242 1:N:0:ACTTGA. Could you help me do it?
Thanks,
Fuyou

[Brian Bushnell]

What do you want to do with the headers?

[GenoMax]

Since every fastq header is going to start with "@HWI-ST1234" you could check for the longer string rather than just "@". Or you could take advantage of the periodicity (every nth line will be a header) as long as your sequences don't warp around.