SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   the format of output file of Maq (http://seqanswers.com/forums/showthread.php?t=4375)

zcrself 03-17-2010 01:58 AM
the format of output file of Maq
 
Code:
HWI-EAS-249_42:1:1:10:282#0/2        chromosome01        8649295        -        0        0        0        0        0        11        20        0        12        76        aattccaaggagcctgcttgacctgtgtttcgtctgaacttcaaccctcctcgatgctgcttctctaagctgaacT        ########################################!############################;4864:A
HWI-EAS-249_42:1:1:10:1227#0/2        chromosome01        8757671        -        0        0        19        19        19        10        25        0        0        76        gagtcgttaaaaaaaatctatttcttagggttatttcttgggggacggaagattatactccccccgtcctataatA        #########################################9;9(;779479(949(9;98;;8;78679696;9B
HWI-EAS-249_42:1:1:12:1701#0/2        chromosome01        11998357        +        0        0        19        19        19        15        36        0        0        76        CaacGGattggctggtgacaccgatatctgactttatggctcgcgcctgtggtgggacccagcgtcgtgggcgggg        B55,??335###################################################################
HWI-EAS-249_42:1:1:11:1076#0/2        chromosome01        12313108        -        0        0        6        6        6        6        10        0        0        76        aaatcagcttcccaagatgtcgtacccccagaatggtcataatttacggatgttctcatttcattaacaaaaCCtT        ##########################################!#############################@?0?
HWI-EAS-249_42:1:1:11:637#0/2        chromosome01        13502430        +        0        0        19        19        19        6        12        0        0        76        cggatttaattggatagatatatctatacggttaaacttgagtgcaggacctccgactggttcacctatacgcact        ############################################################################
this file was produced by Maq-0.7.1
what means of every columns?

zcrself 03-17-2010 11:15 PM
the format of map which is produced by Maq
 
read name, chromosome, position, strand, insert size from the outer coorniates of a pair, paired flag, mapping quality, single-end mapping quality, alternative mapping quality, number of mismatches of the best hit, sum of qualities of mismatched bases of the best hit, number of 0-mismatch hits of the first 24bp, number of 1-mismatch hits of the first 24bp on the reference, length of the read, read sequence and its quality

nilshomer 03-18-2010 12:09 AM
Quote:
Originally Posted by zcrself (Post 15613)
read name, chromosome, position, strand, insert size from the outer coorniates of a pair, paired flag, mapping quality, single-end mapping quality, alternative mapping quality, number of mismatches of the best hit, sum of qualities of mismatched bases of the best hit, number of 0-mismatch hits of the first 24bp, number of 1-mismatch hits of the first 24bp on the reference, length of the read, read sequence and its quality
See:
http://maq.sourceforge.net/maq-manpage.shtml
http://maq.sourceforge.net/maqmap_format.shtml


All times are GMT -8. The time now is 02:48 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.