SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Epigenetics (http://seqanswers.com/forums/forumdisplay.php?f=24)
-   -   ATAC-seq (Read1/Read2/Index Sequencing Primers?) (http://seqanswers.com/forums/showthread.php?t=70636)

emacalate 08-02-2016 10:14 AM

ATAC-seq (Read1/Read2/Index Sequencing Primers?)
 
Hi,

We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper.

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad2.1 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

Does anyone know the Read1/Read2/Index primers to use to read out sequences from ATAC-libraries on the Illumina sequencer (for paired end sequencing)? Are these custom primers?

I was told to use Nextera sequencing primers, but I can't figure out how these work for ATAC-libraries. Maybe I have the wrong sequences downloaded?

Any help would be greatly appreciated!

Thanks,

Steve

SeleneT 08-30-2016 12:11 PM

ATAC sequencing primers
 
Hello,
if you're sequencing on Illuminas NextSeq, their sequencing kits higher than v2 include Nextera primers.
I presume the most recent versions of HiSeq kits should be the same, though I've yet to sequence with them, so check with Illumina tech support or whomever you'll be sequencing with to be sure.
If not, or you're planning to use an older chemistry version kit, the Nextera kit should have come with indexing primers. Check with Illumina's web site for correct dilutions to add, or your sequencing service provider should be able to help. Happy sequencing!
Selene.


All times are GMT -8. The time now is 09:36 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.