SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Illumina/Solexa (http://seqanswers.com/forums/forumdisplay.php?f=6)
-   -   Can I use default sequencing primers for Miseq? (http://seqanswers.com/forums/showthread.php?t=91858)

Tom2013 11-26-2019 09:43 AM

Can I use default sequencing primers for Miseq?
 
I use below PCR primers to prepare libraries for Miseq amplicon sequencing:

i7-INDEX2-Spacer- gene_specific_Primer

CAAGCAGAAGACGGCATACGAGAT TCGCCTTA GTCTCGTGGGCTCGG +gene_specific_Primer

i5-INDEX2-Spacer+gene_specific_Primer
AATGATACGGCGACCACCGAGATCTACAC-CTCTCTAT-TCGTCGGCAGCGTC+gene_specific_Primer

Compared to Nextera adapters, my primers do not include the tagmentation sequence. I tried to look up Miseq sequencing primers, but still not sure whether my adapters are compatible with Miseq sequencing primers.

Can I use default sequencing primers in Miseq cartridge for sequencing? Does anybody know any website or document to verify that?

ATϟGC 11-26-2019 11:07 AM

My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf

Tom2013 11-26-2019 11:16 AM

Quote:

Originally Posted by ATϟGC (Post 229653)
My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf

Thanks a lot for your reply.
Are there any document/post(s) mention that "the sequencing primer binding site is actually contained within the Nextera transposase sequence"?

Tom2013 12-02-2019 11:47 AM

Quote:

Originally Posted by ATϟGC (Post 229653)
My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf

You are right!


All times are GMT -8. The time now is 08:00 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.