SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Sample Prep / Library Generation (http://seqanswers.com/forums/forumdisplay.php?f=25)
-   -   PE Adaptors (http://seqanswers.com/forums/showthread.php?t=77753)

cement_head 08-25-2017 07:08 AM

PE Adaptors
 
In the lastest Illumina Sequence Letter, the Paired End DNA Oligonucleotides are now listed as "Obsolete". Does that mean/imply that they will no longer work on HiSeq2500 (and MiSeq) flow cells?

Code:

Oligonucleotide Sequences for Paired End DNA
(Obsolete)
PE Adapters
5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 2.0
5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
PE Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE Read 2 Sequencing Primer
5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT


cement_head 08-25-2017 10:39 AM

No, it means that Illumina no longer "SELLS" these adaptors...


All times are GMT -8. The time now is 05:04 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.