SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Illumina/Solexa (http://seqanswers.com/forums/forumdisplay.php?f=6)
-   -   Illumina/Solexa Genome Analyzer Primer/Adapter Sequences (http://seqanswers.com/forums/showthread.php?t=198)

ECO 04-07-2008 08:53 AM

Illumina/Solexa Genome Analyzer Primer/Adapter Sequences
 
The following sequences were obtained from here (**):

Sequences for Solexa Library Preparations:

Genomic DNA oligonucleotide sequences

Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

PCR Primers 1
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

Genomic DNA Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT


DpnII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-GATCGTCGGACTGTAGAACTCTGAAC
5 ACAGGTTCAGAGTTCTACAGTCCGAC

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

NlaIII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-TCGGACTGTAGAACTCTGAAC
5' ACAGGTTCAGAGTTCTACAGTCCGACATG

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CCGACAGGTTCAGAGTTCTACAGTCCGACATG


Small RNA oligonucleotide sequences

RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

**disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences! :D

sci_guy 04-09-2008 04:58 AM

Bravo! Just what I needed.

horigen 04-10-2008 04:37 AM

Very useful!
I refined these sequences. Hopes they're clearer.


Genomic DNA

Adapter:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------- 5'
Adapter:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
PCR Primer:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'
PCR Primer:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
Genomic DNA Sequencing Primer:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'

DpnII gene expression

Gex Adapter 1:
5' -------------------A CAGGTTCAGAGTTCTACAGT CCGAC--------------- -------------------- ------ 3'
3' -------------------- ---CAAGTCTCAAGATGTCA GGCTGCTAGp---------- -------------------- ------ 5'
Gex Adapter 2:
5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 1:
5' -------------------- -------------------- ----------------------------------------- ------ 3'
3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATCNNNNNNNNNNN NNNNNTCGTATGCCGTCTTC TGCTTG 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAGNNNNNNNNNNN NNNNNAGCATACGGCAGAAG ACGAAC 5'
Gex Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC----------- -------------------- ------ 3'
3'--------------------- -------------------- -------------------- -------------------- ------ 5'

NlaIII gene expression

Gex Adapter 1:
5' -------------------A CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
3' -------------------- ---CAAGTCTCAAGATGTCA GGCTp--------------- -------------------- ------ 5'
Gex Adapter 2:
5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 1:
5' -------------------- -------------------- -------------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACATGNNNNNNNNNNNN NNNNNTCGTATGCCGTCTTC TGCTTG 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGTACNNNNNNNNNNNN NNNNNAGCATACGGCAGAAG ACGAAC 5'
Gex Sequencing Primer:
5' ----------------CCGA CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'

Small RNA

5' RNA Adapter:
5' -------------------- ---GUUCAGAGUUCUACAGU CCGACGAUC (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
3' RNA Adapter:
5' -------------------- -------------------- --------- (-)pUCGUAUGCCGUCUUCUGCUU GUidT 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
RT Primer:
5' -------------------- -------------------- --------- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 1:
5' -------------------- -------------------- --------- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA----- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATC (N) TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAG (N) AGCATACGGCAGAAGACGAA C 5'
Small RNA Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'


Two errors have been corrected. (Genomic DNA Adapter & Small RNA Result Library)
I'm sorry for that and other potential errors.

ECO 04-10-2008 09:04 AM

Thanks Horigen! That definitely clarifies things!

If anyone is having trouble viewing, make sure your browser is as wide as it can go.

tec 05-16-2008 02:12 AM

Hello,
just one question.

We want to synthesize the adapters by ourselves.
Its necessary to phosphorylate the 5' end of the adapters additional?
(there is still no 5' phosphate?)

Thanks a lot!

sci_guy 07-16-2008 12:09 AM

The P.E adaptors/primers have been added at the original link.

dandestroy 09-18-2008 08:13 PM

Sorry for the small font, but that's the only way I could make it fit


Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

sigusn 10-03-2008 05:48 AM

Can someone explain to me why the Illumina adapters need to be 5-phosphorylated? In the very similar SOLiD sample prep protocol the adapters are not phosphorylated.:confused:

sci_guy 10-03-2008 06:16 AM

Illumina adaptors need 5' phosphorylation for the ligation. The newer SOLiD protocol uses a "nick translation" like step where the "nick" left over from ligating primers without a 5'-phosphate is translated to (or near enough to) the primer terminus. One strand will ligate as there is a 5' phosphate on the end repaired template DNA. The SOLiD adaptors are blunt-ended on the termini designed for ligation, whereas the Illumina adaptors use a T overhang to create incompatible ends. If the SOLiD primers had 5' phosphate groups there would be a LOT of P1-P2, P1-P1 or P2-P2 ligated product; hence the nick translation like step. Nice clever twist.

swaroom 10-03-2008 12:31 PM

What conditions do I use to anneal the adapters and what concentration is optimal for ligation of adapters to the fragmented genomic DNA. I am ordering the Illumina primers through Invitrogen. ::)

Jenny Russ 10-27-2008 03:51 AM

mRNA-Seq adapter sequences?
 
The sequences above are really helpful. Does anyone also have the sequences for mRNA-Seq? This would be really great!!!

Joanne Ho 11-14-2008 02:23 AM

I use PE-adapter to mRNA-seq, it can work properly.

monad 11-21-2008 09:19 AM

mRNA-seq adapters
 
Quote:

Originally Posted by Jenny Russ (Post 2069)
The sequences above are really helpful. Does anyone also have the sequences for mRNA-Seq? This would be really great!!!


mRNA-seq kit uses PE adaptors, and read 1 primer is same as genomic DNA primer for single read sequencing. If you have a PE sample ready, but whatever the reason wants single end sequencing, do that just like for SR sequencing. Done that many times.

berthasalco 12-04-2008 08:30 AM

Hello there,

first at all, i want to thank you to all to coperate to give us the sequence of the GEX 1 and 2 adapters and primers for the tag profilling with DpnII :), but

does anybody know at which concentration are they used??? The Illumina protocol does not give concentrations. According to the Invitrogen LongSAGE protocol the double stranded adapters have a concentration of 40 ng/ul and 1.5 ul are used for one ligation reaction :confused:

thanks a lot,
BS

bioinfosm 12-08-2008 08:43 AM

Hi all,

Thanks for the technical details on this. Anyone got some information about bioinformatics on adapter contamination detection and removal. I tried using adapter sequences with eland to check for contamination, but less than 1% reads aligned. I expected more as less than 10% reads aligned to actual reference.

I know of a file one can specify in GA pipeline, to exclude sequences -- could someone point more details on the same? (i tried bioinformatics thread, but did not hear back :( )

thanks!

breakt1000 01-06-2009 10:44 AM

Multiplex (12-plex) Illumina Adapter/Primer Sequences
 
Hi,

Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)

dvh 01-06-2009 11:49 AM

Quote:

Originally Posted by bioinfosm (Post 2556)
Hi all,

Thanks for the technical details on this. Anyone got some information about bioinformatics on adapter contamination detection and removal. I tried using adapter sequences with eland to check for contamination, but less than 1% reads aligned. I expected more as less than 10% reads aligned to actual reference.

I know of a file one can specify in GA pipeline, to exclude sequences -- could someone point more details on the same? (i tried bioinformatics thread, but did not hear back :( )

thanks!

novoalign has 5' and 3' removal of adapter sequences prior to alignment. works well.
david

graveley 01-24-2009 11:33 AM

Hi,

I run the site you got the sequences from and am happy to see that you have posted the info here as well. I will attempt to keep the list up to date as new sequences are released. If there is any additional info you would like, let me know and I'll post it if possible.

Cheers,

Brent

ECO 01-24-2009 12:59 PM

Hey Brent,

Nice to have you, thanks for being willing to share with the community. :D I'm sure everyone would appreciate any info you have.

danielfortin86 02-06-2009 05:02 PM

Adapter sequence
 
i know that the overhanging T is used to ligate with the added A from the DNA library, but thy is there a one base pair overhang on the other side? If you see how the sequence anneal there is an overhang on both ends. Both adapter sequences are 33 bases. If you only wanted the T overhang, why wouldn't you have 32 bases on one strand and 33 on the strand with the T overhang?


All times are GMT -8. The time now is 03:25 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.