SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   MACS SAMfiles (http://seqanswers.com/forums/showthread.php?t=8474)

khb 12-17-2010 06:26 AM

MACS SAMfiles
 
Hi
I've used MACS to find peaks in a SAM file, and I got a line in the peaks.bed file in SAM with negative start (-98) so I cannot upload the file in UCSC genome browser.
chrM -98 4052 macs_PEAK_50677 971.81
Does somebody understand the reason for this output? Is there a bug in MACS when it finds hits the negative strand?
Thanks

polyatail 12-17-2010 02:01 PM

Hi khb,

What software did you use to produce the alignment? Can you post some of the reads mapping to chrM?


Andrew

khb 12-19-2010 10:37 AM

I used bowtie.
Here is some of the output from bowtie
HWUSI-EAS1525_0005_FC:4:1:7582:8004#0/1 - chrM 313 CCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAA cgcag_^^^[X_LXV]ggggcfccfX_YZZQdbdb_afffdfcffggggg 0
HWUSI-EAS1525_0005_FC:4:1:15912:8129#0/1 - chrM 14456 ATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAA afhhhfhhghhhhfhhhhhhgghhhfghghhghhhhhhhhhhhhhhhhgh 0
HWUSI-EAS1525_0005_FC:4:1:13895:8331#0/1 + chrM 3185 ATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAA ggggcgggggffdcffdfffgggggggggggggggffgggfdafffeccd 0
HWUSI-EAS1525_0005_FC:4:1:10583:8537#0/1 - chrM 12329 TAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTAACTTCC gfgggggggggdgggeffefaffafadde\_d^eefffafffffcebbee 0 6:G>A
HWUSI-EAS1525_0005_FC:4:1:14677:8853#0/1 - chrM 11331 CCAACAACTTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATA ]adcffeffcffcfffcddffcfcdedeee[afcffcffcffdcffffcf 0
HWUSI-EAS1525_0005_FC:4:1:19550:9039#0/1 + chrM 3344 TTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGC hhhhhhhhhhhghghehgghhhhhghfhghhg_hhfcfefgdfffcfdcc 0
HWUSI-EAS1525_0005_FC:4:1:5655:9204#0/1 + chrM 13011 CCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCC hhhhhhghhhhhhhhhhhhghghhhgahgh_ffcchhhhfhchgghhh`h 0
HWUSI-EAS1525_0005_FC:4:1:3891:9219#0/1 - chrM 12759 CATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGAT ccffdagggggddgegffgggggggggffgffffdgfecfcggggggggg 0
HWUSI-EAS1525_0005_FC:4:1:10936:9386#0/1 - chrM 511 CCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCC c[^Y^T[T[Wb]bTbf[feeb`d_ecffdb]deeefff_fafffff`eff 0
HWUSI-EAS1525_0005_FC:4:1:5529:9413#0/1 + chrM 595 CCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATA hhhhhhghhfhhhghhhhhhhhhhhhhhhhghhhfghhhhhhhhhhhhfh 0
HWUSI-EAS1525_0005_FC:4:1:10410:9859#0/1 + chrM 10090 CCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTC gggfgfcffafffdff_fcfffddffffffggfggfa]fcfefcfaffec 0


Thanks :)


All times are GMT -8. The time now is 03:20 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.