SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Non-ATGC characters, small-case characters and lots of 'N's in fastq file's sequence (http://seqanswers.com/forums/showthread.php?t=63239)

gauravdube 10-03-2015 09:11 AM

Non-ATGC characters, small-case characters and lots of 'N's in fastq file's sequence
 
Hi All,

My fastq file consists of lot non-ATGC characters. What are these characters and how to handle these?

Commands used:
bwa index ref.fa
bwa aln -t 9 ref.fa D2_R2.fastq -f D2_R2.sai && bwa aln -t 9 ref.fa D2_R1.fastq -f D2_R1.sai
bwa sampe ref.fa D2_R1.sai D2_R2.sai D2_R1.fq D2_R2.fq > D2-aln-pe2.sam
samtools faidx ref.fa
samtools view -bt ref.fa.fai D2-aln-pe2.sam > D2-aln-pe2.bam
samtools sort D2-aln-pe2.bam D2-aln-pe2.bam.srt
samtools index D2-aln-pe2.bam.srt.bam
samtools mpileup -uf ref.fa D2-aln-pe2.bam.srt.bam | bcftools view -cg - | vcfutils.pl vcf2fq > CONSENSUS.fq


CONSENSUS.fq file looks like:
@scaffold_1
nnngtttggtggtagtattggtatttcaaacacgctaggtgtttgttggttttgagtagg
tgtagctggagtagactctatctccatttctctatcagtttgggcctctggccctaggct
ctcctgtctgttttcttgagtatttactacaatagtatcactgtctggcggcattttatt
actaagctcttttcttagtaagcaactagatggtctgtgtgtttttgttttcgtgagtga
gacgtgttcagattagctactttaccagcttctagctctatagcgcgtgggctgcacgag
ttggcactagttgtaatcgatttcttgggatggatttgtatataattcgctaaaattaca
cctattctgaaaaactcgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnTAATGTTACAAGTAAYAAGAAGGATYCTYTCCTTRACAAATRACGAGATGGC

Please also convey, how to handle the small-case characters and 'N's ?

Thanks in advance.

Brian Bushnell 10-03-2015 09:53 AM

Cross-posted


All times are GMT -8. The time now is 01:12 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.