SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Trimmomatic vs bbduk.sh (http://seqanswers.com/forums/showthread.php?t=75515)

mslider 04-18-2017 06:32 AM

Trimmomatic vs bbduk.sh
 
--Hi,

i have a big difference between results using bbduk.sh and trimmomatic trimming single-end reads, i have used the commands below, trimmomatic kept 99.78% survival reads whereas bbduk 91.76%. I don't know which to consider good or not.
Which parameters do you use to use to trim in a good way single-reads ?

thank you --

java -Xmx10g -jar trimmomatic-0.36.jar SE -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:TruSeq3-SE.fa:2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

TrimmomaticSE: Started with arguments:
-threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:/home/jtazi/save/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:
2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 49512700 Surviving: 49401731 (99.78%) Dropped: 110969 (0.22%)

bbduk.sh Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=13 ktrim=r useshortkmers=t mink=5 qtrim=rl minlength=36 trimq=27

BBDuk version 36.11
Set threads to 8
maskMiddle was disabled because useShortKmers=true
Initial:
Memory: max=8232m, free=7974m, used=258m

Added 2017 kmers; time: 0.570 seconds.
Memory: max=8232m, free=7545m, used=687m

Input is being processed as unpaired
Started output streams: 0.449 seconds.
Processing time: 118.446 seconds.

Input: 49512700 reads 2475635000 bases.
QTrimmed: 7288815 reads (14.72%) 218452414 bases (8.82%)
KTrimmed: 3125475 reads (6.31%) 23413723 bases (0.95%)
Total Removed: 4077445 reads (8.24%) 241866137 bases (9.77%)
Result: 45435255 reads (91.76%) 2233768863 bases (90.23%)

Time: 119.548 seconds.
Reads Processed: 49512k 414.16k reads/sec
Bases Processed: 2475m 20.71m bases/sec

Brian Bushnell 04-18-2017 10:10 AM

See answer here.


All times are GMT -8. The time now is 12:55 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.