SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Sample Prep / Library Generation (http://seqanswers.com/forums/forumdisplay.php?f=25)
-   -   Doing PCR enrichment on PCR-free TruSeq lib? (http://seqanswers.com/forums/showthread.php?t=63251)

JBKri 10-05-2015 03:05 AM

Doing PCR enrichment on PCR-free TruSeq lib?
 
I am making a contingency plan in case our next TruSeq (DNA) PCR-free libraries don't have sufficient yield. As far as I can tell the only difference between TruSeq PCR-free and TruSeq Nano is the DNA input amount and the lack of PCR enrichment at the end of the PCR-free protocol. So if we end up with too low yield it should be possible to do some PCR-cycles with the primers here: http://bioinformatics.cvr.ac.uk/blog...mer-sequences/ :
PCR Primer 1.0 (P5)
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA 3
and
PCR Primer 2.0 (P7)
5 CAAGCAGAAGACGGCATACGAGAT 3

Further, I was thinking we probably have these primers in leftovers from another kit, in the "PCR Primer Cocktail" from a TruSeq stranded mRNA kit. Can anyone confirm this? From the same kit we have only a small amount of PCR Master Mix, so we are thinking to use KAPA HiFi mix instead. Does anyone have an idea of the annealing temperature to use?

kerplunk412 10-05-2015 04:17 PM

Your plan sounds perfect. You can probably find a Kapa library prep protocol on their website, so you can use the PCR conditions from that. I think they are something like 98 degree melt and 65 degree anneal. Also, you should be checking the concentration of your PCR-free libraries by QPCR, so the primers from that kit should work as well.

JBKri 10-08-2015 08:00 AM

Quote:

Originally Posted by kerplunk412 (Post 181923)
Your plan sounds perfect. You can probably find a Kapa library prep protocol on their website, so you can use the PCR conditions from that. I think they are something like 98 degree melt and 65 degree anneal. Also, you should be checking the concentration of your PCR-free libraries by QPCR, so the primers from that kit should work as well.


Thanks. But the primers aren't supplied separately in the qPCR kit we use.

I realized the KAPA documentation specifies the primer sequences in the mix, and they are shorter than those above, especially Primer 1. I don't understand why the P5 primer above is so long. I'll try the KAPA primers and conditions.
Jon


All times are GMT -8. The time now is 03:09 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.