SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   RNASeq - overrepresent sequences (http://seqanswers.com/forums/showthread.php?t=10372)

JoaoMoura 03-28-2011 08:41 AM

RNASeq - overrepresent sequences
 
Hey guys!

First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.

Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:

CGATGAAGAACGCAGCGAAATG

CCCCCTGGAATACCAAGGGGCG

Do you have any idea what they are?

Thanks a lot!

maubp 03-28-2011 10:19 AM

Were any PCR primers used in preparing the sample?

JoaoMoura 03-28-2011 10:58 AM

Hi!

Actually I'm not sure. But background is not biological, but I tried looking in the article and suplementary material, but I didn't find anything.

This is the article:

http://www.plosgenetics.org/article/...gen.1000299#s5


All times are GMT -8. The time now is 06:07 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.