SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Bisulfite sequencing question (http://seqanswers.com/forums/showthread.php?t=78658)

__sequence 10-17-2017 12:02 PM

Bisulfite sequencing question
 
Hi all,

A (may be) stupid question about bisulfite sequencing: Do we in general expect CpGs to be equally methylated on both strands? For example, I am looking at the processed data from this GEO entry: https://www.ncbi.nlm.nih.gov/geo/que...acc=GSM2439648

It looks like the methylation levels of CpGs belonging to the same pair but at different strands are very different (compare columns 4 and 8 below), while the sequencing coverage looks good. How to interpret this?

Thanks!
chr2 3051114 + 35.7143 14 25 12 42.8571 7 45.4545 11 catgaccaatgaaagacgtagaaaacccaacatt
chr2 3052114 + 100 16 93.3333 15 87.5 8 88.8889 18 agctgagccatctccccggccccGACCTAGAACT
chr2 3052120 + 76.4706 17 81.25 16 55.5556 9 76.4706 17 gccatctccccggccccGACCTAGAACTCTTTAG
chr2 3052240 + 30.7692 13 27.7778 18 20 10 22.2222 9 cagttgaaagccaccacgttgatgctgggaattg
chr2 3052311 + 50 12 46.6667 15 75 12 87.5 8 cacctgagacatctctcGACCCAGGCACTGTGTT
chr2 3052400 + 90.9091 11 84.6154 13 90 10 62.5 8 ATCACTTGTCCAAACTCGAAACCGGTAATCCAGA
chr2 3052406 + 75 12 92.8571 14 90 10 100 6 TGTCCAAACTCGAAACCGGTAATCCAGAAAGCCA
chr2 3052493 + 50 8 50 12 44.4444 9 42.8571 7 TGAATGCTGTGGGCACCGGGAACCCTGCACACCT
chr2 3052712 + 80 10 85.7143 7 77.7778 9 70 10 AAGTACAGGTTGATGGCGCAGACCAGCGCCATGA
chr2 3052722 + 44.4444 9 22.2222 9 60 10 36.3636 11 TGATGGCGCAGACCAGCGCCATGATGCAGGAAGT
chr2 3052756 + 80 10 100 11 100 9 92.8571 14 GATGGCTTTGCTCAACCGGCCGTTGGCAAACTCC

dpryan 10-17-2017 02:39 PM

Yes, most methylation is symmetric, I haven't a clue why they're always getting such large differences between strands.


All times are GMT -8. The time now is 07:37 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.