SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   RNA Sequencing (http://seqanswers.com/forums/forumdisplay.php?f=26)
-   -   Odd sequences in RNAseq fastq (http://seqanswers.com/forums/showthread.php?t=91763)

Kujin Kwon 11-19-2019 10:31 PM

Odd sequences in RNAseq fastq
 
Hi all,

Recently, I just ran iSeq for pair ended RNA sequencing and it gave me odd fastq results
Some of Read1(i7) sequences have Adapter sequences with poly G at the end.

@FS10000436:35:BPC29621-1807:1:1101:10010:1370 1:N:0:1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF::FFFFFFFF:FFFFFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

However paired Read2(i5) sequences gave me random and poor quality sequences
@FS10000436:35:BPC29621-1807:1:1101:10010:1370 2:N:0:1
GGGGGGGGGAATTTTTTTTTTTTAAAAAATATTTTTTTTTCTTTTTTTTTTTTTTTTTTCCCTTTTTTTTTTTATATTTTTTTTTTTTTTTTTATATTTTT
+
F:,,,,,,,,,,,F,,:,:FFF,,,::FF,,,,FFF,,,,,:,FFF::FF::,F::F,,,,,,,F,FF::::,,,,,,::F:FFFFFFF,F,,,,,,,,,:

I guess this problem came from library length which is shorter than sequencing length. However, I can't understand why Read2 sequence doesn't show matched short sequences (like adapter with G sequences) but random sequences. Is it cluster problems by short sequences?

Thanks in advance.

cmbetts 11-20-2019 02:29 PM

I take it these are NextSeq or NovaSeq?

This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no signal = G in 2 color chemistry

GenoMax 11-21-2019 03:31 AM

OP says these are from iSeq.

cmbetts 11-21-2019 08:36 AM

Whoops. Same conclusion though. Gs are still the dark channel in the iSeq chemistry

Kujin Kwon 11-24-2019 08:09 PM

Thanks for the answer @cmbetts

Quote:

no template = no signal = G in 2 color chemistry
Then, random sequence in read2 is also signal of no template?


All times are GMT -8. The time now is 05:02 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.