SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   454 Pyrosequencing (http://seqanswers.com/forums/forumdisplay.php?f=5)
-   -   454 titanium emulsion PCR problems? (http://seqanswers.com/forums/showthread.php?t=2733)

kjones 10-02-2009 05:31 AM

454 titanium emulsion PCR problems?
 
Has anyone else been experiencing problems with titanium emPCR? We have been having a lot of failed runs that can't be attributed to sequencing problems...the control fragments look fine. The emPCR seems to go fine...we get an enriched recovery within the normal range, but then the sequencing is an utter failure, apart from the control reads of course. This is happening across multiple library types (standard shotgun Titanium Paired End Titanium), and from samples of different types from different sources. We haven't changed our library prep approach recently, so we keep focusing on the emPCR as the potential problem. We have heard that Roche has started using a new vendor for their emPCR additive and are wondering if this is related, but can't get confirmation from Roche. Anyone else seeing this?

boss_hoss 10-08-2009 12:46 PM

have you seen any broken emulsion wells? do your library traces look normal? what is your enrichment percentage specification range?

Claudia Stewart 10-09-2009 06:07 AM

emPCR problems
 
Yes, we have - we were told they are 'unseen broken reactors', meaning that even though these were inspected at emPCR completion and found to be non- biphasic (ie not obviously broken) that there can be broken reactors that are not visibly biphasic.
We have not seen this in FLX chemistry only Ti chemistry.
It is a major bummer.

boss_hoss 10-09-2009 10:53 AM

we had a similar problem with specifically SVE setups, where we were seeing a ton of broken wells and poor enrichments. it turned out to not only be an oil lot problem, but an oil problem that spanned across two separate oil lots. it was really hard to diagnose. we ended up switching to the newest lot available and it solved the problem.

Soulbee 07-27-2010 11:08 AM

I ve been having a problem with emPCR as well with the enrichment step. I used the same reagents and one LV oil from the same kits to process two different samples. During the enrichment step, there has been a bit of a problem in washing away of the sequencing beads "6-10" times that are not bound to the enrichment beads.

one sample was enriched and processed fine during this stage, only requiring about 10 washes until no more white sequencing beads were being washed out. The second sample however kept releasing the unbound white beads even after 30-40 washes. The input of the library I put into emPCR was very low so I know this was probably not due to having too much template to start with. Anyone having this similar problem or can speculate as to why this may be? This has happened to a few of other samples as well.. thanks!

Debabrata. 07-29-2010 10:39 PM

Hello,
I would like to know the exact sequence of Adaptor A and Adaptor B of Roche 454.

proteasome 08-01-2010 10:04 AM

Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon

Debabrata. 08-02-2010 03:31 AM

Thanks
 
Simon,

Thank you so much.

Debabrata.

uhany 08-05-2010 12:23 AM

Hi

I am having serious problem in beads recovery after emulsion PCR. It seems all the beads are getting washed off ....and I have left with no beads for sequencing..does anyone have similar problems?? please help..

Soulbee 08-05-2010 06:58 AM

no, my problem is usually the opposite where too little beads are being washed off even though very small amount of template beads were added in the first place. If they are all being washed off and you have done everything else properly upto this point, your enrichment primer may not have bound properly to your DNA which means they just cant bind to the enrichment beads. Check the status of your adaptors as wells as your enrichment primers... ?

uhany 08-06-2010 01:08 AM

thanks soulbee
 
well enrichment primers are from the kits and they are not outdated ..so far I have done everything according to the protocols..so I don't know what went wrong..I tried different kits as well...:confused:

tplsmith 08-06-2010 12:28 PM

There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.

On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.

uhany 08-09-2010 12:13 AM

thanks a lot tplsmith..I was thinking the same as well..

Soulbee 08-10-2010 10:21 AM

Hey do you guys know if the sequencing kits are in backorder right now and how long it may take to get them?

Also, during full processing of your sequencing data, its says "410 reads were capped" .. any idea what this means? Thank you!

pmiguel 08-12-2010 07:55 AM

Quote:

Originally Posted by proteasome (Post 22799)
Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon

Simon,

Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.

Phillip

kmcarr 08-12-2010 10:53 AM

Quote:

Originally Posted by proteasome
Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon
Quote:

Originally Posted by pmiguel (Post 23452)
Simon,

Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.

Phillip


These are the Amplicon primer sequences. If you use these sequences you would need to use the Lib-A emulsion kit

naxin 08-18-2010 08:34 AM

Quote:

Originally Posted by tplsmith (Post 23178)
There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.

On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.

Do you mean the emPCR kit with the new emulsion Oil? I run two emPCR, and 3 out of 4 cups have problem.

rmprieto 08-19-2010 05:11 AM

We have been doing some Lib-A SV experiments recently, and we have a similar problem: in spite of increasing the amount of template, the enrichment percentage remains poor. Do you have any information regarding the kit numbers that are defective? Maybe we are facing the same problem than you have found.

RCJK 09-01-2010 06:31 PM

Has anyone had issues lately with broken emulsions, specifically with MV and/or LV? I've not had this issue until a few weeks ago. The lots of oil involved were MV: 93750020 & 93766120, LV: 93771120. The emulsions do not look completely broken, but many of the wells have a bead pellet at the bottom, with a clear layer, and then a white layer above that. I've repeated the same samples across two lots of MV oils and have had the same thing. The LV reactions were a different set of libraries (one Lib-A and one Lib-L) and also showed the same. Roche is being rather quiet about this and not offering any other suggestions to me other than possibly sending a new kit to try it again.

gallus 09-02-2010 05:58 AM

1 Attachment(s)
we've been having problems with SV lots (93768220 and 93776220). they look like the emPCR is the issue though no obvious broken reactors. the attached 1/8 Ti bacterial genomic was deemed "good" by the Roche engineer we talked to (though i disagree). we've sequenced the same type of sample/prep from this PI with lot 9378740 and beautiful distribution with avg of 500 bp. now, hardly any reads above 400 bp with a very odd peak at 120 bp. we've submitted RunReports etc to support with only the normal "we've received your message" response. any others have this lot (especially *8220)?


All times are GMT -8. The time now is 04:09 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.