SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   using primer3+ design primers received a warning? (http://seqanswers.com/forums/showthread.php?t=58169)

arkilis 04-30-2015 04:55 PM

using primer3+ design primers received a warning?
 
When I use primer3+ to do the primer design. It gives out a warning:

Checking for poly-A and poly-T regions >= 7 bp, and potential hairpins ( >= 85% GC in a 30 bp window):

Amplimer 1: Poly-A region in amplimer TTGGAGGAAGATGCTTAGCC[...]GGTTAATGAAGTGTGGAGACTCC

What does this mean? Thanks


All times are GMT -8. The time now is 03:24 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.