SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   SAM to BAM conversion issue (http://seqanswers.com/forums/showthread.php?t=22839)

rndouglas 08-27-2012 01:46 PM

SAM to BAM conversion issue
 
All of a sudden a problem with SAM to BAM conversion has cropped up for me.

I used Bowtie 1 to map sRNA reads to a sequence of interested and had a SAM file outputted:

Code:

@HD        VN:1.0        SO:unsorted
@SQ        SN:centc        LN:11067
@PG        ID:Bowtie        VN:0.12.8        CL:"bowtie -f -S --al /Users/birchlerlab/Desktop/TB9Sb1_centc_aligned.fa /Users/birchlerlab/Desktop/maize_centromeres/centc.fa /Users/birchlerlab/Desktop/TB9SB1_filtered_18_28nt.fa"
CTATAAGTCTGTGAAGGTGTCTT        4        *        0        0        *        *        0        0        CTATAAGTCTGTGAAGGTGTCTT        IIIIIIIIIIIIIIIIIIIIIII        XM:i:0
AAGGGGTCGACACAGTTTAGCATG        4        *        0        0        *        *        0        0        AAGGGGTCGACACAGTTTAGCATG        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
CCTTCTATCGACGGAGCAGGACGCC        4        *        0        0        *        *        0        0        CCTTCTATCGACGGAGCAGGACGCC        IIIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
CATAACGAAGAAACCCTAGCCT        4        *        0        0        *        *        0        0        CATAACGAAGAAACCCTAGCCT        IIIIIIIIIIIIIIIIIIIIII        XM:i:0
ATGAATGTAGATGAAGGGAACTCA        4        *        0        0        *        *        0        0        ATGAATGTAGATGAAGGGAACTCA        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
GAGGATAGCCAAGAGTTCAGGGCC        4        *        0        0        *        *        0        0        GAGGATAGCCAAGAGTTCAGGGCC        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
GTGAGTTGAGAATCCATGCGGGCG        4        *        0        0        *        *        0        0        GTGAGTTGAGAATCCATGCGGGCG        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
GTGAGTTGAGAATCCATGCGGGCG        4        *        0        0        *        *        0        0        GTGAGTTGAGAATCCATGCGGGCG        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
AAGGAGAGTAAGAATTAACAGTGT        4        *        0        0        *        *        0        0        AAGGAGAGTAAGAATTAACAGTGT        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0
AAGGAGAGTAAGAATTAACAGTGT        4        *        0        0        *        *        0        0        AAGGAGAGTAAGAATTAACAGTGT        IIIIIIIIIIIIIIIIIIIIIIII        XM:i:0

Everything seemed okay at that point, and I wanted to throw the output into IGV to visualize the reads when it yelled at me (rightfully so) that my SAM file was unsorted.

Aha! I thought I would just convert to BAM then sort, then go back to IGV.

So I used this to convert SAM to BAM:

Code:

samtools view -bS ~/TB9SB3.sam > ~/TB9SB3.bam
Then I went to sort the file and it finished instantly. I knew something was not right so I looked at my BAM file and it looked like garbled trash (see photo from a related sample).

http://i97.photobucket.com/albums/l2...7at44230PM.png

Any suggestions on what I might have done to screw things up? I have installed nothing/deleted nothing since my SAM to BAM conversions were working well last week.
My previous SAM to BAM converstions were with Tophat output though. Does Bowtie output not do well with a conversion?

nilshomer 08-27-2012 02:43 PM

BAM files are compacted and compressed, so you wont be able to read them in a text viewer. Try converting back from BAM to SAM to see if you get the original SAM file.

rndouglas 08-27-2012 03:10 PM

Of course! Thank you!

I'm guessing I just entered a bad sort command now.


All times are GMT -8. The time now is 06:05 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.