SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Trimmomatic adapter file vs Custom made file (http://seqanswers.com/forums/showthread.php?t=75814)

candida 05-03-2017 12:29 AM

Trimmomatic adapter file vs Custom made file
 
Hello everyone,


I am working with TruSeq paired end data (150bp). I have a doubt regarding the adapter file provided in Trimmomatic for trimming adapters.

According to the Trimmomatic provided adapter file "TruSeq3-PE-2.fa" the reverse complement of index adapter sequence is used for trimming reads from R2 file and the universal adapter is used for trimming reads from R1 file.
>PrefixPE/1 TACACTCTTTCCCTACACGACGCTCTTCCGATCT

>PrefixPE/2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

>PE1 TACACTCTTTCCCTACACGACGCTCTTCCGATCT

>PE1_rc AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

>PE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

>PE2_rc AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

However, it looks like that for my data the actual sequences of the index adapter is in the R1 file and the reverse complement of the universal adapter is in the R2 file.

This information was also provided to me by Illumina support team.
https://support.illumina.com/bulleti...-trimming.html

Therefore I prepared my adapter file as follows (I'm using the full sequence):
>PrefixPE/1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG (index adapter)

>PrefixPE/2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT ( reverse complement of universal adapter)

>PE1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

>PE1_rc CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (revcomp of PE1)

>PE2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

>PE2_rc AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (revcomp of PE2)

Please let me know if this adapter file I prepared is fine or is the Trimmomatic adapter file better and needs to be used always.
I tried my custom made file as well as the Trimmomatic recommended file and found that both removed adapters when checked using FASTQC!!

Please correct me or let me know if I'm missing something!
Appreciate your help and guidance!
Thanks,
Candida

GenoMax 05-03-2017 03:07 AM

For reference cross posted: https://www.biostars.org/p/250425


All times are GMT -8. The time now is 03:30 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.