![]() |
Bowtie problem when mapping against short sequences, no positions.
Hi All,
I want to use Bowtie to align reads to exons and junctions. I have created fasta files of the junctions and exons, indexed them and so on. When I run bowtie I end up with aligned reads without mapping information. Code:
WICMT-SOLEXA_100421_61T4HAAXX:6:25:11235:11821#0/1;0 4 * 0 0 * * 0 0 CGGGGCATAGGGGTACTTCTCAAGTGGGGAATGCCATATGAAGTGGAGCATACATGGGGGCACACAATTCCA@####################################################################### XM:i:0 I'm using bowtie version 0.12.7. Would truly appreciate some help! Boel |
Problem solved.
The flag is 4 = unmapped reads.
Unable to delete my first message - sorry about that. |
All times are GMT -8. The time now is 12:24 AM. |
Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.