SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Bowtie poroblem when mapping against short sequences, no positions. (http://seqanswers.com/forums/showthread.php?t=8885)

Boel 01-14-2011 08:33 AM

Bowtie problem when mapping against short sequences, no positions.
 
Hi All,

I want to use Bowtie to align reads to exons and junctions. I have created fasta files of the junctions and exons, indexed them and so on. When I run bowtie I end up with aligned reads without mapping information.

Code:

WICMT-SOLEXA_100421_61T4HAAXX:6:25:11235:11821#0/1;0        4        *        0        0        *        *        0        0        CGGGGCATAGGGGTACTTCTCAAGTGGGGAATGCCATATGAAGTGGAGCATACATGGGGGCACACAATTCCA@#######################################################################        XM:i:0
WICMT-SOLEXA_100421_61T4HAAXX:6:25:11235:13629#0/1;1        4        *        0        0        *        *        0        0        GTCCCGGCTCACTCAACCTCCACTTCCCAGGTTCAAGCGATTCTCCTGCCTCAGGCTCCCAAGTAGCTGGGAGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFCGGFGGFGFGDGGGGGGGGFGGECFEEFFEDFCFEEEFDBC        XM:i:0
WICMT-SOLEXA_100421_61T4HAAXX:6:25:11235:17639#0/1;1        4        *        0        0        *        *        0        0        CCAGACCGTATTCCACCGCTTCAGGGGCGGAAAGGAAGCGATCGCGCTCGGTATCACGTTCAATCTGTTCTAGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGEGGGGDFGGGGFEFFGGDGFGFFGEFGFFFDFGEGGGG        XM:i:0

I know that spaces and pipes in the reference names can be a problem, so I don't have those in my names. The reference names are however quite long (chr1:196945439-196945639:+:ENSG00000081237 and similar). Names such as ENSG00000081237_1_196945439_196945639 makes no difference.

I'm using bowtie version 0.12.7.

Would truly appreciate some help!
Boel

Boel 01-14-2011 09:54 AM

Problem solved.
 
The flag is 4 = unmapped reads.

Unable to delete my first message - sorry about that.


All times are GMT -8. The time now is 12:24 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.