![]() |
Lots of "N" in the barcode.
Dear All
I am new to NGS and GAII. After several test running ,we have a big problem:confused:. We usually have 6 samples with different barcode(index 2,3,4,7,9,10) in one lane. We have 3.5G data totally in each lane, but the CASAVA only can demultiplexing 64M. Most of data under Undetermined_indices fold are like this. @=78@==<:=BDDDDGEGG?===B@>ACBAGGGG@DD==>EEE?EDGE3GEEC>>,838<E>>C???D?=6(/9?:?######################## @ILLUMINA-8ACF53:7:FC:1:52:5835:9761 1:N:0:NNNNGN TAAACTTTATAATTAAAAAAAAATGCTCATTTGAGCTGCAATAGTTTTACTAACTTTTAATGTCTTAATTCAAATACCCAGTTTCCATAACATAATATCTA There lots of N in the barcode,so CASAVA cann't demultiplex samples. We have a little bit overclustering. %PF of my sample is only 29.5+/- 27.32. Is this the main reason? How to make troubleshooting with this? Thank you so much. |
There is nothing you are going to be able to do when samples are over-clustered (~30% PF is a clear indication) and the tag read fails this way.
You will have to re-run these samples at a lower density. |
Thank you so much.
How to improve the %PF? Do you have some advises? Quote:
|
Quote:
As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries. You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem. |
Thank you so much.
I only got this problem in lane1 and lane2. And the every sample's concentration of lane1 is 8pM. The cluster Density is 1153+/-98,Cluster PF is 29.46+/- 27.44. This is the first time that I prepared the library by myself. And Lane1 is the TEST lane. The other lanes were good libraries. I measured the concentrations by Bioanalyzer since our Real-time PCR meachine was out of order. So I think the concentrations were not accurate. Thank you so much again. Quote:
|
Quote:
I sent all may SAV file to illumina techsupport ,after analyzed my data,they said that "HP8 did not hybridize with those IDT sample preps. The intensity readings of index 1 is nearly zero, which accounts for not seeing index counts in your results. Since the index 1 worked in the other lanes, it is likely not a index primer fluidics issue on the instrument. This would also confirm the effectiveness of the HP8 primer in the system." I used IDT Y shape TruSeq dup Adapter for my libraries preparation. The sequence of the adapter as follow. TruSeq Universal Adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGA TC *T-3 TruSeq Indexed Adapter GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACA-CGAGAAGGCTAG*P-5 I ordered TruSeq SBS Kit v5 - GA (36-cycle)(FC-104-5001) for our GA IIx and TruSeq PE Cluster Kit v2(PE-300-2001) for cBot. Did I make mistake about my adapters? Thanks |
I don't think the adapters were the problem. As the others have said, you were way too overclustered in that lane. You can try upping the mismatch rate or playing with the failed reads to get some more data back, but the chances of getting even 50% of your data back are pretty slim.
Next time you encounter overclustering in your flow cell, I would suggest immediately performing a strip and rehyb of your primers and restarting the run. This will usually lower the cluster density a little bit. |
All times are GMT -8. The time now is 07:23 AM. |
Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.