SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Illumina/Solexa (http://seqanswers.com/forums/forumdisplay.php?f=6)
-   -   QIAseq FX DNA Library Kit adapters for trimming (http://seqanswers.com/forums/showthread.php?t=91458)

ciemanek 10-23-2019 04:31 AM

QIAseq FX DNA Library Kit adapters for trimming
 
Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?

GenoMax 10-23-2019 04:42 AM

Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGENŽ QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.

Addendum : Those are just index/barcode sequences.

ciemanek 10-28-2019 01:19 AM

Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.

nucacidhunter 10-28-2019 11:57 PM

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.

ciemanek 10-29-2019 01:19 AM

Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?

I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).

GenoMax 10-29-2019 03:14 AM

You may not have any adapters present if your inserts were of a good size and there was no read-through.

BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.

nucacidhunter 10-29-2019 03:22 AM

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA


Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

ciemanek 10-29-2019 03:44 AM

Thanks a lot! :)


All times are GMT -8. The time now is 07:53 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.