SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Given BAM/SAM file, how to see if it's single-end or paired-end sequencing? (http://seqanswers.com/forums/showthread.php?t=32694)

xxatbio 08-10-2013 06:39 AM

Given BAM/SAM file, where to find its read length information?
 
Given BAM/SAM file(for example the BAM file I posted below), where to find its read length information?
Thank you!!

a BAM file by samtool view

SL-XAN_2_FC30BV1AAXX:1:47:1108:971 161 chrM 2 37 51M = 416 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT 77777777777777777777777777777766644122122222222.222 XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:17:1367:1052 97 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTT 77777777777777777777777777777774+44-222222/2222222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:48:1493:1675 161 chrM 3 37 51M = 396 0 TCACAGGGCTATCACCCTATTAACCACTCACGGGAGCGCTCCATGCATTTG 66,66666666666666666(66666666$66'6+,2'22!)'2,22,222 XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:7T29T13
SL-XAN_2_FC30BV1AAXX:1:2:1699:495 1121 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTT 7753577770757777777777777-777-71+1'/22221/%2/2*222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:94:521:1276 97 chrM 4 37 51M = 326 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 77777777777777777777777777777707777222222/2/2*222/% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:38:989:254 97 chrM 4 37 51M = 416 0 CACAGGGCTATCACCCTCTTAACCACTCACGGGAGCTCTCCGTGCATTTGC 777707(77.777777((77(.77-3.777-/+17,#2222%21*-1*2(% XT:A:U NM:i:4 X0:i:1 X1:i:0 XM:i:4 XO:i:0 XG:i:0 MD:Z:6T10A23A8G0
SL-XAN_2_FC30BV1AAXX:1:13:1440:514 1121 chrM 4 37 51M = 108 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGT 777777777777777777777777777777777%72222221222-222-% XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:4:428:1682 1121 chrM 4 37 51M = 327 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 77777777777777777777777777777747477222222-2)2%222%% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:55:771:1939 1121 chrM 4 37 51M = 327 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 777777.777777777777777777777777+3-12221-2-2/1*222%+ XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:53:1454:1186 97 chrM 4 37 51M = 108 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 77777777777777777777777777777777477222222%212-2221% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51

dpryan 08-11-2013 02:48 AM

It's just the length of the 10th column (the sequence). Note that the reads can be of different lengths, particularly if they were trimmed.

xxatbio 08-11-2013 02:51 AM

Quote:

Originally Posted by dpryan (Post 113185)
It's just the length of the 10th column (the sequence). Note that the reads can be of different lengths, particularly if they were trimmed.

Thank you !


All times are GMT -8. The time now is 08:23 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.