SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   BWA Segmentation Fault (aln) (http://seqanswers.com/forums/showthread.php?t=5167)

raela 05-18-2010 06:41 AM

BWA Segmentation Fault (aln)
 
I'm trying to align 79 bp illumina reads to the horse genome. I'm using a 64 bit system with 8 GB ram. It fails within seconds, using 37,958 reads. Any ideas on how to get bwa working?

example read:
@ILLUMINA-904D83_0001:6:1:1514:5295#0/1-unm
TGCTGCGGAGGGAGAGAAAGAGGAGGCTTGTAAATGGACTGTTATTCTTCCCCTGGACTCTGTGGTACACATAGGCGC
+
CCCCCCCCCCCCCCCCCACC1CC@C=AAA2@CCCC2A+AA?CCCCCBC*@AAA+;>@8@A%%%%%%%%%%%%%%%%%%!

(gdb) run aln equcab2.fa unm.fq
Starting program: /usr/local/genome/bin/bwa aln equcab2.fa unm.fq
[Thread debugging using libthread_db enabled]
[bwa_aln] 17bp reads: max_diff = 2
[bwa_aln] 38bp reads: max_diff = 3
[bwa_aln] 64bp reads: max_diff = 4
[bwa_aln] 93bp reads: max_diff = 5
[bwa_aln] 124bp reads: max_diff = 6
[bwa_aln] 157bp reads: max_diff = 7
[bwa_aln] 190bp reads: max_diff = 8
[bwa_aln] 225bp reads: max_diff = 9



[bwa_aln_core] calculate SA coordinate... [New Thread 0x7f01b0c4b6f0 (LWP 24977)]

Program received signal SIGSEGV, Segmentation fault.
[Switching to Thread 0x7f01b0c4b6f0 (LWP 24977)]
bwt_2occ (bwt=0x636a10, k=4294967295, l=904726057, c=1 '\001',
ok=0x7fff4f2880e4, ol=0x7fff4f2880e0) at bwt.c:100
100 bwt.c: No such file or directory.
in bwt.c
(gdb) bt
#0 bwt_2occ (bwt=0x636a10, k=4294967295, l=904726057, c=1 '\001',
ok=0x7fff4f2880e4, ol=0x7fff4f2880e0) at bwt.c:100
#1 0x000000000040518b in bwt_cal_width (rbwt=0x636a10, len=78,
str=0x637400 "\001\003\001\003\001\003\001\002\001\003\001",
width=0x12f72e0) at bwtaln.c:63
#2 0x00000000004054b9 in bwa_cal_sa_reg_gap (tid=0, bwt=0x7fff4f288280,
n_seqs=37958, seqs=<value optimized out>, opt=0x62f010) at bwtaln.c:121
#3 0x0000000000405a91 in bwa_aln_core (prefix=0x7fff4f28a592 "equcab2.fa",
fn_fa=<value optimized out>, opt=0x62f010) at bwtaln.c:185
#4 0x0000000000405e51 in bwa_aln (argc=251, argv=0x7fff4f2883f0)
at bwtaln.c:297
#5 0x00007f01b0056526 in __libc_start_main () from /lib64/libc.so.6
#6 0x0000000000401869 in _start () at ../sysdeps/x86_64/elf/start.S:113


All times are GMT -8. The time now is 12:48 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.