SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   Why is BBmap throwing java error (http://seqanswers.com/forums/showthread.php?t=87666)

horvathdp 02-13-2019 02:00 PM

Why is BBmap throwing java error
 
Hi all,

I have some myseq data that I want to clean up using bbmap. When I give the following command, I get this error. What is wrong? I am guessing it is having a problem with the sequence I downloaded from the vendor, but I can't figure out what the issue is. Help???

./bbduk.sh in1=Plate1_clean1_R1.fastq in2=Plate1_clean1_R2.fastq out1=Plate1_clean2_R1.fastq out2=Plate1_clean2_R2.fastq qtrim=rl trimq=20 minlen=70

java -Djava.library.path=/home/dave/bbmap/jni/ -ea -Xmx103643m -Xms103643m -cp /home/dave/bbmap/current/ jgi.BBDukF in1=Plate1_clean1_R1.fastq in2=Plate1_clean1_R2.fastq out1=Plate1_clean2_R1.fastq out2=Plate1_clean2_R2.fastq qtrim=rl trimq=20 minlen=70
Executing jgi.BBDukF [in1=Plate1_clean1_R1.fastq, in2=Plate1_clean1_R2.fastq, out1=Plate1_clean2_R1.fastq, out2=Plate1_clean2_R2.fastq, qtrim=rl, trimq=20, minlen=70]

BBDuk version 35.82
Initial:
Memory: max=104150m, free=100346m, used=3804m

Input is being processed as paired
Started output streams: 0.025 seconds.
Exception in thread "Thread-5" java.lang.AssertionError:
Error in Plate1_clean1_R1.fastq, line 1046, with these 4 lines:
GTTCGTCTCTACACTGACGACATGGTTCTACAGTCCATGTGAATACGAAGGGAAGCATTTTTTTTAAAAAGTAAATTGTTTTGTATACTGCAGTACTATGGGCTATGGTGAGACCAAGTCTCTGCTACCGTATGCGTCAGAAGATCGGAAT
+
>1>>1>AAFFDFEGGDAGEAEEE1FGHHHHHHHHHHHHHHHFHHHHHGCFGCF0E/1DFGHHGGGE1@G1AGHHHHHHHGHGEHBGHHHHHFFHHFHFG2BFFHHHHHF1101>?CFHHHHHFH1EG1FCFHHGH?EC/?11<CGHHG///
@M00619:318:000000000-B4H7N:1:1101:17348:2448 1:N:0:ATCACGAT+TCTTTCCC

at stream.FASTQ.quadToRead(FASTQ.java:722)
at stream.FASTQ.toReadList(FASTQ.java:653)
at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:111)
at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:76)
at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:643)
at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:635)
Exception in thread "Thread-6" java.lang.AssertionError:
Error in Plate1_clean1_R2.fastq, line 1145, with these 4 lines:
TCACGCTATGTACGGTAGCAGAGACTTGGTCTGGTTGCTTATTGGGTTACGGTTTGATTGTTGATTCGTGGTGGTACAACTTTAGTGACGGATGGTGATTGTTGTGATGGTAAGCTAAGGTCGTGTAGAACCATGTCGTCAGTGTCATAGC
+
1>>>AFAA?FFBGGCGGGFFGGHFBGHH1GGHHFDGGHFHHGHFFHFFGACFF/EEBDGFFDGFGHFEHEFACEEHHEHFFHH@GG12FFE/>E/F1@2GF@DGHF2221F2B>1B1B1FGHEE/?F12EDHAGEDGAFF//BBF2>FFF1
@M00619:318:000000000-B4H7N:1:1101:14067:2496 2:N:0:ATCACGAT+TCTTTCCC

at stream.FASTQ.quadToRead(FASTQ.java:722)
at stream.FASTQ.toReadList(FASTQ.java:653)
at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:111)
at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:76)
at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:643)
at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:635)

GenoMax 02-13-2019 04:34 PM

Can you try running by specifying the memory by adding "-Xmx4g" to your command?


All times are GMT -8. The time now is 06:19 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.