SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Bioinformatics (http://seqanswers.com/forums/forumdisplay.php?f=18)
-   -   some problems in using integrative genomics viewer (http://seqanswers.com/forums/showthread.php?t=16201)

magarine 12-13-2011 04:25 PM

some problems in using integrative genomics viewer
 
Hi all.
I want to use IGV for viewing my BAM file data which I generated by Hiseq2000.
Using ELANDv2, the data was aligned to hg18 and called SNP and small IN/DEL.
However, when I open the BAM file as output data of ELANDv2 on IGV, any data is not shown.
As searching the reason, I could find this suggestion - http://www.broadinstitute.org/softwa...ata/#aliasfile
So, I made the alias file and located the location that page mentioned.
But, the result is same with before.
Is anyone help me?
Below is my sample SAM data.

@HD VN:1.0 SO:coordinate
@PG ID:CASAVA VN:CASAVA-1.8.1 CL:/usr/local/bin/configureBuild.pl --id /illumina2/data/111020_SN336_0133_AB0BEYABXX/Data/Intensities/BaseCalls/Aligned/Project_A --od /illumina2/data/111020_SN336_0133_AB0BEYABXX/Data/Intensities/BaseCalls/VariantProjectA --ref /data/pub_data/hg18 -f
@SQ SN:chr1.fa LN:247249719
@SQ SN:chr2.fa LN:242951149
@SQ SN:chr3.fa LN:199501827
@SQ SN:chr4.fa LN:191273063
@SQ SN:chr5.fa LN:180857866
@SQ SN:chr6.fa LN:170899992
@SQ SN:chr7.fa LN:158821424
@SQ SN:chrX.fa LN:154913754
@SQ SN:chr8.fa LN:146274826
@SQ SN:chr9.fa LN:140273252
@SQ SN:chr10.fa LN:135374737
@SQ SN:chr11.fa LN:134452384
@SQ SN:chr12.fa LN:132349534
@SQ SN:chr13.fa LN:114142980
@SQ SN:chr14.fa LN:106368585
@SQ SN:chr15.fa LN:100338915
@SQ SN:chr16.fa LN:88827254
@SQ SN:chr17.fa LN:78774742
@SQ SN:chr18.fa LN:76117153
@SQ SN:chr19.fa LN:63811651
@SQ SN:chr20.fa LN:62435964
@SQ SN:chrY.fa LN:57772954
@SQ SN:chr22.fa LN:49691432
@SQ SN:chr21.fa LN:46944323
@SQ SN:chrM.fa LN:16571
HWI-ST336_133:2:1208:9721:194569 137 chr1.fa 10 25 22M1D17M1D60M * 0 0 CCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAA CCFFFFFHHGHHJJJJJJJJJJJDHI?:C8DH8?FEHI>?D@G3?BBCGCB=C@FD7@@?C=?EBDFBCCEAC=?AD;(9?<9<?<938<A8<?##### BC:Z:0 XD:Z:22^A$17^A$60 SM:i:25 AS:i:0
HWI-ST336_133:2:1208:9721:194569 69 chr1.fa 10 0 * =10 0 TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGATAGGGATAGGGCTGGGGTGGGGGTTCGGTGTG @@DFFFDHDHHHFHFEHIGIGIIHGIGGGIIG?GGHBF9DACBAFFGGCB6=>CDE########################################### H0:i:255 H1:i:135 H2:i:83 BC:Z:0
HWI-ST336_133:4:2101:19741:191800 153 chr1.fa 12 11 99M *0 0 CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAA ################???95(BA;(5(?CA?;6BED?C=HC@(D=IHF=C=EBB289BGF@D9IIHGF?IGGDF?HEECA?JIIIIHGHHHDADDDB? BC:Z:0 XD:Z:99SM:i:11 AS:i:0

hanshart 12-13-2011 10:36 PM

Hi,

From http://www.broadinstitute.org/software/igv/BAM:
Quote:

Indexing: IGV requires that both SAM and BAM files be sorted by position and indexed
You can use samtools for sorting and indexing the BAM file using the commands
Code:

samtools sort aln.bam aln.sorted
samtools index aln.sorted.bam

Maybe this helps

cheers

magarine 12-13-2011 11:10 PM

Thanks Hanshart.

Actually, ELAND's result has sorted.bam and sorted.bam.bai file.

Please I need your help. experts.

Alex Renwick 12-14-2011 06:35 AM

Does IGV show any error message?

Be sure you're using the sorted.bam file. IGV will find the associated index file from the name and ".bai" extension, but it won't go looking for the sorted file if you give an unsorted one.

One possibility is that you need to zoom in. At the whole genome level nothing is shown. The data doesn't show up until the window is zoomed so that the window spans less than 50kb.

magarine 12-14-2011 03:25 PM

Thanks Alex Renwick.

Your point is correct.
When I zoomed window as soon as install and data load, the computer was down by unexpected error.
But, now IGV works well.

Thank you for your advise and help.


All times are GMT -8. The time now is 09:38 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.