SEQanswers

SEQanswers (http://seqanswers.com/forums/index.php)
-   Illumina/Solexa (http://seqanswers.com/forums/forumdisplay.php?f=6)
-   -   TruSeq compatible PCR primers (http://seqanswers.com/forums/showthread.php?t=12342)

ETHANol 06-28-2011 06:35 AM

TruSeq compatible PCR primers
 
I'm doing ChIP-seq and would like to start using the TruSeq Adaptors for barcoding (single read). I have the sequences of the TruSeq adaptors from Illumina but they do not give out the sequences of the PCR primers.

Has anyone made their own PCR primers that work with the TruSeq adaptors?

If it's not illegal to post this trade secret, does anyone know the sequence of the Illumina PCR primers for TruSeq?

kmcarr 06-28-2011 12:47 PM

Illumina does not want the information posted to public forums but will provided it to you simply by asking. See this thread (post #4 in particular) for further details:

http://seqanswers.com/forums/showthread.php?t=8564

ETHANol 06-28-2011 01:19 PM

They give out the sequences for the adaptor primers but not the PCR primers. Or at least that is the file they gave me.

ETHANol 07-03-2011 12:38 AM

Somebody must be making their own TruSeq PCR primers (PCR Primer Cocktail as Illumina calls it).

Anyway, after looking at the old and new adaptor sequences, I was going to give the following primers a try:

5' aatgatacggcgaccaccga*g
5' CAAGCAGAAGACGGCATACGA*G
*=phosphothiorylate bond

Seems like it should work. Anybody have any opinion?

bbeitzel 07-06-2011 05:00 AM

Those look OK according to my understanding of the final library fragments. I don't think you need the phosphorothioate linkages, though.

ETHANol 07-06-2011 06:25 AM

Thanks. I put the order in. We'll see if it works.

The phosphorotiolation is suppose to increase efficiency with proofreading polymerases. Maybe it's not necessary but it couldn't hurt.
http://nar.oxfordjournals.org/conten.../3551.abstract

I also Googled my primer sequences and found this:
http://openwetware.org/images/1/10/Geller_exome.pdf

So it seems like it should work.

pmiguel 07-06-2011 06:35 AM

Quote:

Originally Posted by ETHANol (Post 45769)
Thanks. I put the order in. We'll see if it works.

The phosphorotiolation is suppose to increase efficiency with proofreading polymerases. Maybe it's not necessary but it couldn't hurt.
http://nar.oxfordjournals.org/conten.../3551.abstract
[...].

Just to be clear:
The phosphorothioate linkages are not susceptible to (or are less susceptible to?) exo-nucleolytic enzymes.

The hallmark of a high fidelity enzyme is a 3'->5' exonuclease activity. So there is a connection there. But really the idea is that if your adapters have 3' overhangs that you don't want to get nibbled back by "end polishing" enzymes (eg T4 polymerase) that did not get completely removed/deactivated in an earlier step, then you put in the phosphorothioate linkages.

--
Phillip


All times are GMT -8. The time now is 04:30 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.