Bowtie and reads that failed to align: (100.00%)
 

Hello,
Can someone help me please. I have some new paired-end sequence from illumina and the reads are not aligning. What am I doing wrong? An example of the reads are below with the commandline I am using. I would be grateful for any help, cheers.

Read from sequence file #1
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
GCTCCAGTATAGGGGAATGCCAGGACTAGGAAGAGGGATTGTGTGGTTTGGAGAGCAGGACGGAGGGAGGGTATACGTCACTATGAGATGGGAAACTTGTA
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
ccccc_ca\c[[]X]JYJVRRHSXHMMNYVPVZEIWFFYXXZ_Z]cbccb_J[G_VPZUF^X`H`^YD`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HISEQ2000_0110:4:68:14861:199831#GCACTG/1


Read from sequence file #2
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
CACTTTAAAATCTATTTGATCTTGAGGAAATCAGTTGTGTTTCCTAGTTATATAGTCTATCATTTAATAATAGCACTAATGAAGTGTTTAGAAGTAATAAT
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
ggggggggggfbfIffffefggggeggggeU^cf_eedfee^ZZ\accdd]eeeeffedfI[bbbcYccbeaeddgggaedTcc_dbfdIc\c\P_ZM_BB


Commandline
./bowtie -t -p 14 -q -I 0 -X 300 -S --chunkmbs 2048 mus -1 ../working/s_temp_1.txt -2 ../working/s_temp_2.txt ../working/s_temp_aligned.sam

Hi michy,

The command you used looks ok-ish, but

(a) -q is the default, however Bowtie will then assume Phred33 qualities. The HiSeq seems to chuck out Phred64 encoded data though, try specifiying -q --phred64-quals
(b) -I 0 is not not required as it is the default
(c) If you still don't get any alignments you might want to increase -X to a higher value, maybe your insert sizes are just larger than 300bp?

Hope (a) or (c) will fix it.

Hello fkrueger,
thank you for your reply. Your suggestions esp. a) and c) they did improve the alignment by 15% which means 85% still failed to align. However, I was testing the command on a small subset of the data. I will try some more reads and get back to you.

Thank you again and any other suggestions welcome.

Michy

May I ask if you used FastQC on your sequence files to find out whether you are sequencing into the adapter on the other side? This might throw mapping efficiencies off quite a bit and can be fixed by trimming adapter sequences off or just shortening the sequences a bit.

Hello fkrueger,
I've never tried this software but I will now, it looks very useful.

Thank you,
Michy

I used the command: bowtie -p 4 /rs4244385A

And reads that failed to align: (100.00%)

Can help me?

Help!
 

anyone?????

Your first read has lousy quality scores, and its best blast to mouse has several discrepancies. That's why it won't align. The second read should align fine.

rs4244385 is a human SNP.