SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 1 of 1
Search took 0.00 seconds.
Search: Posts Made By: daddyodevil
Forum: RNA Sequencing 08-02-2017, 09:00 AM
Replies: 0
Views: 728
Posted By daddyodevil
How to use mirna and mrna sequences in bowtie2?

I have two files.

1. An mrna file in which each line looks like -

NR_030382 chr1:100154611-100178513 tattaggttggtgcaaaagtaattgtggtttttgcctgtaaaag

2. An mrna file whose lines are like -
...
Showing results 1 to 1 of 1

 


All times are GMT -8. The time now is 12:58 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO