
Go Back   SEQanswers > Search Forums

Showing results 1 to 2 of 2
Search took 0.01 seconds.
Search: Posts Made By: khunny7
Forum: Bioinformatics 02-02-2011, 12:45 PM
Replies: 3
Views: 2,115
Posted By khunny7
Thanks for you reply, I can see that there are...

Thanks for you reply, I can see that there are many matches but that sequence is not repetitive over chromosome 6.
I did the local blast against hg19, and I could find only a single match.
Forum: Bioinformatics 02-01-2011, 04:41 PM
Replies: 3
Views: 2,115
Posted By khunny7
Different starting position in Genbank blast result?

I am new to this field and this probably a very ignorant question.
However, when I did a blast search with following sequence, "TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG" blast...
Showing results 1 to 2 of 2


All times are GMT -8. The time now is 11:46 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO