SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 26
Search took 0.00 seconds.
Search: Posts Made By: madsaan
Forum: Bioinformatics 06-27-2011, 01:24 PM
Replies: 1
Views: 2,000
Posted By madsaan
OK.figured it out!!

OK.figured it out!!
Forum: Bioinformatics 06-22-2011, 02:52 PM
Replies: 1
Views: 2,000
Posted By madsaan
bowtie- paired end - no alignments

Hi my command for a paired end read is as follows:

./bowtie -v 0 -a -p 2 -X 300 hg19 -c -1 TGGGAGATATACCTAATGCTAGATGACCCA, -2 AAGTTTAGGGTACATGTGCAGGTTAGTTA


and am getting a message that says...
Forum: Bioinformatics 06-22-2011, 08:26 AM
Replies: 0
Views: 1,249
Posted By madsaan
Cool bowtie paired end mismatches

Hello,

If we specify -v 2 for a paired-end read,does bowtie allow two mismatches for the pair or is it for each read?

Thanks.
Forum: Bioinformatics 06-14-2011, 07:16 AM
Replies: 1
Views: 1,895
Posted By madsaan
Question BWA - sampe max occurrences of a read for pairing

Hello,

Can anyone explain what the parameter -o means for sampe.According to BWA manual it says "A read with more occurrences will be treated as a single-end read.Reducing this parameter helps...
Forum: Bioinformatics 06-10-2011, 08:27 AM
Replies: 1
Views: 2,182
Posted By madsaan
Exclamation tophat hg19 index

Hi,

I was wondering if it is ok to use the pre built hg19 index from Tophat for BWA as the reference genome or should I build an index by myself?

Thanks,
Joji
Forum: Bioinformatics 06-03-2011, 09:10 AM
Replies: 4
Views: 2,765
Posted By madsaan
Exclamation FASTQC for checking quality of 120 bp reads

Hello,

I am trying to check the quality of my GA11 illumina reads that are 120bp long and I am getting very low median values after the 70th bp.I would like to know if FASTQC is a reliable tool...
Forum: Bioinformatics 05-27-2011, 12:44 PM
Replies: 7
Views: 3,990
Posted By madsaan
hello edge, I initially thought fragment...

hello edge,

I initially thought fragment length meant read length.Mine was 84 bp and I gave that as read length and i ended up without the warning message but my results were the same.When I later...
Forum: Bioinformatics 05-16-2011, 04:14 PM
Replies: 7
Views: 3,990
Posted By madsaan
Exclamation cuffdiff single end reads

hello,

am running cuffdiff between two single end reads and even thought it runs fine am getting a message as follows:

using default gaussian distribution due to insufficient paired-end reads...
Forum: Bioinformatics 05-16-2011, 07:33 AM
Replies: 1
Views: 4,123
Posted By madsaan
Exclamation same xloc id but different tcons id with same exons

Hello,

I am trying to find differentially expressed genes bteween two samples and looked at the cuffcompare.combined.gtf file and noticed the following




Why am I getting different TCONS...
Forum: Bioinformatics 05-16-2011, 07:18 AM
Replies: 1
Views: 1,819
Posted By madsaan
Question extract gene names from enscafg id

Hello,

I ran the latest version of cufflinks and it gives me only the enscafg as gene id.I would like to get the gene names for these enscafg ids.Is there a table or database that provides this?
...
Forum: Bioinformatics 03-24-2011, 06:40 AM
Replies: 0
Views: 1,819
Posted By madsaan
Question depth of coverage basic question

Hi,

I am a newbie to NGS analysis.I was wondering how useful it is to view/calculate depth of read coverage for discrete intervals of the chromosome/genome.What can we infer from it ?I understand...
Forum: Bioinformatics 03-21-2011, 01:37 PM
Replies: 0
Views: 1,514
Posted By madsaan
gene.fpkm_tracking file has empty class_code and nearest_ref_id

Hi,

My gene.fpkm_tracking looks like the following

...
Forum: Bioinformatics 02-10-2011, 06:51 AM
Replies: 4
Views: 4,047
Posted By madsaan
hi brachysclereid, You should put a chr in...

hi brachysclereid,

You should put a chr in front of Un and other chromosome numbers as well.it should work after that.

Thanks,
Joji
Forum: Bioinformatics 02-10-2011, 05:24 AM
Replies: 4
Views: 4,047
Posted By madsaan
thanks dnusol for your reply.I used a gene...

thanks dnusol for your reply.I used a gene annotation.gtf file for cuffcompare.I am getting -1.79769e+308 in the ln(fold change) column so quite confused.

Thanks,
joji
Forum: Bioinformatics 02-09-2011, 06:58 AM
Replies: 3
Views: 3,281
Posted By madsaan
Question Different fpkm values for cuffdiff and cuffcompare

Hi,

I have noticed that some of my FPKM values are 0 in the gene_exp.diff file.I did notice that it was not 0 in the transcripts.tmap file.Does anyone know why does this is happening.

Thanks,...
Forum: Bioinformatics 02-09-2011, 06:33 AM
Replies: 4
Views: 4,047
Posted By madsaan
Question fold change value-cuffdiff

Hi,

I am trying to find the fold change between male and female gonad using cuffdiff.it seems to be working fine but am getting a value of -1.79769e+308.Now I need to find the top ten up and down...
Forum: Bioinformatics 01-26-2011, 05:25 AM
Replies: 0
Views: 1,192
Posted By madsaan
Question undetermined strand

Hi,


Everytime I run cuffcompare with reference gff file and the transcripts.gtf from cufflinks I get a warning saying "found 6004 transcripts with undetermined strands" .What does it mean?
...
Forum: Bioinformatics 01-25-2011, 12:22 PM
Replies: 1
Views: 1,696
Posted By madsaan
I figured out why I was getting no matches.The...

I figured out why I was getting no matches.The chr is represented as Un,X ,1 etc instead of chrUn and so on.After fixing that am getting a warning saying " found 59 transcripts with undetermined...
Forum: Bioinformatics 01-25-2011, 11:51 AM
Replies: 1
Views: 1,696
Posted By madsaan
refmap empty

Hi ,

My cufflinks and cuffcompare commands are as follows.For some reason my refmap file is empty except for the header file.The chr name in both files are the same.not sure why it is not finding...
Forum: Bioinformatics 01-25-2011, 07:13 AM
Replies: 1
Views: 1,505
Posted By madsaan
Question cufflinks error

Hi,

I am getting the following errors in cufflinks.


./cufflinks: /usr/lib64/libz.so.1: no version information available (required by ./cufflinks)
[bam_header_read] EOF marker is absent....
Forum: Bioinformatics 01-17-2011, 01:13 PM
Replies: 0
Views: 1,453
Posted By madsaan
tophat indexing

Hi,

I have a couple of questions regarding the input files for tophat.I am aligning RNA-Seq reads with canfam2(dog) genome.

1.Do I have to create an index file for the RNA-seq reads like...
Forum: Bioinformatics 01-14-2011, 09:14 AM
Replies: 1
Views: 2,236
Posted By madsaan
Novoalign parameters

Hi,

I am new to novoalign and totally lost with so many parameters for aligning my transcriptome with reference genome.Which parameters are the most important and how do i go about deciding which...
Forum: Bioinformatics 01-12-2011, 09:33 AM
Replies: 3
Views: 4,304
Posted By madsaan
Question Varscan for snp detection instead of gatk

Hi,

I am trying to detect snp's in a pooled sample of total RNA.I understand that GATK is a very popular tool for variant detection ,SNP & Indel discovery.I would like to know if it is possible...
Forum: Bioinformatics 01-12-2011, 08:55 AM
Replies: 2
Views: 2,643
Posted By madsaan
thanks for the reply.My q1 values start at 40 and...

thanks for the reply.My q1 values start at 40 and end at 32.My q3 values start at 40 and end at 38.That means 25% of the scores are below the corresponding value for each cycle.Then how will I know...
Forum: Bioinformatics 01-11-2011, 05:46 AM
Replies: 2
Views: 2,643
Posted By madsaan
fastx quality score

Hi ,

I am new to NGS analysis and trying my hand at fastx toolkit.I am trying to assess the quality of my sequence and part of the result is below.I would like to know the following

1.should we...
Showing results 1 to 25 of 26

 


All times are GMT -8. The time now is 08:33 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO