SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 35
Search took 0.01 seconds.
Search: Posts Made By: lran2008
Forum: Bioinformatics 06-11-2015, 07:51 AM
Replies: 2
Views: 1,507
Posted By lran2008
Thanks, Michael! ~cow+day is indeed much easier...

Thanks, Michael! ~cow+day is indeed much easier for me to understand.
Forum: Bioinformatics 06-08-2015, 06:04 AM
Replies: 2
Views: 1,507
Posted By lran2008
DESeq2 experimental design question

Hi,

I am having some problems with my DEseq2 experimental design (RNA-seq raw read counts). Basically, I have two treatment (sf, ls). Within each treatment, there are six cows with 3 time...
Forum: Bioinformatics 12-03-2013, 12:03 PM
Replies: 0
Views: 1,187
Posted By lran2008
how to find out the miRNA with the same seed region

Dear all,

If I know a seed region of a miRNA (aggacug), how can I find out which miRNAs in human and mouse share this same miRNA seed region? I tried to search in miRbase, but I can't get what I...
Forum: Bioinformatics 11-04-2013, 08:38 AM
Replies: 8
Views: 3,004
Posted By lran2008
Hi, have you found out how to do it? I am also...

Hi, have you found out how to do it? I am also having this problem.
Forum: Bioinformatics 09-13-2013, 08:09 AM
Replies: 3
Views: 4,398
Posted By lran2008
There are some studies which actually spike-in...

There are some studies which actually spike-in miRNA for normalization.
eg. http://onlinelibrary.wiley.com/doi/10.1002/ijc.25376/full

I am a beginner, so could you point out the reason why this...
Forum: Bioinformatics 09-13-2013, 05:28 AM
Replies: 3
Views: 4,398
Posted By lran2008
miRNA qPCR normalization by spike-in miRNA

Hi All,

There are some commonly used reference genes for normalization of miRNA qPCR, like 5S, 18S rRNA and U6 snRNA. But they might not be the right one in a specific tissue. So would spike-in...
Forum: Bioinformatics 09-05-2013, 05:38 AM
Replies: 3
Views: 2,449
Posted By lran2008
Thanks. This is exactly what I need.

Thanks. This is exactly what I need.
Forum: Bioinformatics 08-30-2013, 08:47 AM
Replies: 3
Views: 2,449
Posted By lran2008
EdgeR DE results of two treatments questions

Hi all,

I am using edger to find DE genes among two time points (P7, P28) compared with control. In my experiment, 6 cows were subjected to treatA and 5 cows were subjected to treatB. I have the...
Forum: Bioinformatics 08-27-2013, 07:22 AM
Replies: 7
Views: 7,551
Posted By lran2008
Sorry, I didn't notice it. I don't know what's...

Sorry, I didn't notice it. I don't know what's the output format by online blast. But if it can be opened by excel or be imported in to R, you could get what you want then.
Forum: Bioinformatics 08-27-2013, 07:10 AM
Replies: 1
Views: 1,280
Posted By lran2008
edgeR for paired cases

Hi all,

I am using EdgeR for DE analysis. I would appreciate if somebody could help me check my experiment design.

I have 6 cows (2,63,66,67,73,74) for a treatment, each with 3 time...
Forum: Bioinformatics 08-27-2013, 06:59 AM
Replies: 7
Views: 7,551
Posted By lran2008
You could choose the Blast output format by...

You could choose the Blast output format by setting -outfmt. Try -outfmt 6 .
Forum: Bioinformatics 08-26-2013, 01:14 PM
Replies: 0
Views: 1,596
Posted By lran2008
draw figure with genomic position of miRNA on each chromosome

Hi All,

Could anybody tell me how to draw a figure as is shown in the attachment? Briefly, I want to draw the location of identified miRNA on each chromosome.

Thanks.
Forum: Bioinformatics 08-15-2013, 01:00 PM
Replies: 1
Views: 2,420
Posted By lran2008
blast against Repbase using Repeatmasker or blast

Hi all,

I would like to filter out the reads which matches with the repeats from miRNA seq data.

I am planing to use blastn to blast my data against the repeats fasta file from Repbase...
Forum: Bioinformatics 08-14-2013, 10:21 AM
Replies: 9
Views: 4,142
Posted By lran2008
This should work. I didn't try it,so I don't know...

This should work. I didn't try it,so I don't know whether it can output a fasta file for unmatched seq.
Forum: Bioinformatics 08-13-2013, 01:49 PM
Replies: 9
Views: 4,142
Posted By lran2008
Thanks very much. The script works perfectly!

Thanks very much. The script works perfectly!
Forum: Bioinformatics 08-13-2013, 01:43 PM
Replies: 9
Views: 4,142
Posted By lran2008
Thanks. The second command didn't work.

Thanks. The second command didn't work.
Forum: Bioinformatics 08-13-2013, 09:27 AM
Replies: 9
Views: 4,142
Posted By lran2008
how to split a fasta file according to a list of gene ID

Hi ALL,

I have a fasta file and I want to split it in two two fasta files according to a list of sequence names in a text file (one seq name per line). So those seqs which have a match with the...
Forum: Bioinformatics 08-13-2013, 05:22 AM
Replies: 2
Views: 2,392
Posted By lran2008
I indeed named it oddly. Anyway, it produced...

I indeed named it oddly. Anyway, it produced results, but seems to be unreliable... The e value for 62-796337 is 1e-10 in the attached picture. So what's your suggestion for the e value cutoff?
Forum: Bioinformatics 08-12-2013, 12:38 PM
Replies: 2
Views: 2,392
Posted By lran2008
blast result against rfam database

Hi All,

I am blasting my miRNA-seq fasta file against rFam data base. Here is the command line I used:
blastn -query TOTAL_mapped_reads.fa -task megablast -db Rfam.fasta -out mapped_vs_rfam.txt...
Forum: Bioinformatics 08-01-2013, 12:36 PM
Replies: 17
Views: 5,612
Posted By lran2008
Hi, thank you for your suggestions. I will try to...

Hi, thank you for your suggestions. I will try to use bowtie 2 instead. But I am still not sure as Bowtie 2 or bowtie works best when aligning to large genomes according to their...
Forum: Bioinformatics 08-01-2013, 10:50 AM
Replies: 17
Views: 5,612
Posted By lran2008
Hi Adam, Your guidelines are very helpful! I...

Hi Adam,

Your guidelines are very helpful! I am new in this area and I have been looking for ways to download rRNA/tRNA data. Bowtie can do the job, but blastn should preform better as is...
Forum: Bioinformatics 07-31-2013, 12:43 PM
Replies: 17
Views: 5,612
Posted By lran2008
I am really stuck here. It would be quite helpful...

I am really stuck here. It would be quite helpful if anybody can provide me some examples on how to blast against Rfam.
Forum: Bioinformatics 07-31-2013, 08:56 AM
Replies: 17
Views: 5,612
Posted By lran2008
remove rRNA/tRNA from miRNA seq data

Hi All,

I am beginner at miRNA analysis. Now I am working on miRNA annotation.I have been working on it for several days but still have no idea how to do it.:(
What I want is to annotate and...
Forum: Bioinformatics 07-30-2013, 11:34 AM
Replies: 2
Views: 1,156
Posted By lran2008
Hi Heisman, thanks for your reply. The collapsed...

Hi Heisman, thanks for your reply. The collapsed file included the unique reads:

>1-30176523
TCAGTGCACTACAGAACTTTGT
>2-17234938
TTCAAGTAATCCAGGATAGGCT
>5-10273189
TACCCTGTAGAACCGAATTTGT...
Forum: Bioinformatics 07-30-2013, 10:06 AM
Replies: 2
Views: 1,156
Posted By lran2008
count reads number in collapsed file

Hi all,

I used bowtie to align a collapsed fasta file to the bovine genome and get a fasta file (mapped.fa) including all the mapped reads. But this mapped.fa is also a collapsed file. So how...
Showing results 1 to 25 of 35

 


All times are GMT -8. The time now is 01:28 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO