SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 4 1 23 Last »
Showing results 1 to 25 of 89
Search took 0.01 seconds. Search: Posts Made By: Giorgio C
Forum: Bioinformatics 10-05-2013, 11:53 AM
Replies: 10
Views: 2,354
Posted By Giorgio C
Smile Sure John, this is a very useful forum

Sure John,

this is a very useful forum
Forum: Bioinformatics 07-03-2013, 06:56 PM
Replies: 7
Views: 7,684
Posted By Giorgio C
I tried to google it, but couldn't find what I...

I tried to google it, but couldn't find what I was looking for. Btw the link you posted seems to be good...THANKS a lot!
Forum: Bioinformatics 07-03-2013, 03:32 PM
Replies: 7
Views: 7,684
Posted By Giorgio C
Add count numbers to headers in a fasta file

Hi all,

I have a fasta file with the same header for each sequence, I would like to add natural numbers at the end of each line:

>OakDna
ACTCTAAATCAGTGCGAG...
>OakDna
AAAAACCCTTTACACTTT......
Forum: Bioinformatics 03-28-2013, 01:49 PM
Replies: 3
Views: 2,610
Posted By Giorgio C
Thanks vivek it works great!

Thanks vivek it works great!
Forum: Bioinformatics 03-28-2013, 10:53 AM
Replies: 3
Views: 2,610
Posted By Giorgio C
convert a text file in fasta with decollpasing

Hi all,

I have this file:

TGAGGTAGTAGATTGTATAGTT 424866
TAGCTTATCAGACTGATGTTGA 359141
TAGCTTATCAGACTGATGTTGAC 276052
TGAGGTAGTAGGTTGTATAGTT 268735
ACAGTAGTCTGCACATTGGTT 209280...
Forum: Bioinformatics 03-14-2013, 05:21 PM
Replies: 1
Views: 2,263
Posted By Giorgio C
Hi, I know it's an old post but I was wondering...

Hi, I know it's an old post but I was wondering if you finally get the right way, in terms of parameter, for the analysis of miRNA in Shrimp.

Since I have to start from the beginning and there is...
Forum: Bioinformatics 03-14-2013, 03:36 PM
Replies: 0
Views: 921
Posted By Giorgio C
How to filter Shrimp aligner output

Hi all,

I'm using Shrimp to analyze a set of miRNAs. Do you know any way or any scripts to filter and organize the output from Shrimp?

Like collapsing, filter out the alignments with indels or...
Forum: Bioinformatics 01-24-2013, 09:49 AM
Replies: 3
Views: 3,474
Posted By Giorgio C
Thank you so much for your time and suggestions....

Thank you so much for your time and suggestions. Actually I tried 'batch entrez' and as you reported, it's not so good; so you're right about that.

I really like your last option and I'm gonna try...
Forum: Bioinformatics 01-24-2013, 07:14 AM
Replies: 3
Views: 3,474
Posted By Giorgio C
Extract multiple sequences on ncbi by gene symbol

Hi all,

I have a lot of gene symbols belonging to the same organism and I need to extract the corresponding sequences on ncbi.

The gene symbol are all like: NMB0001, NMB0010, NMB0015...

Is...
Forum: Bioinformatics 11-19-2012, 12:49 PM
Replies: 0
Views: 1,752
Posted By Giorgio C
Editing a Kegg Ortholgy file for metagenomic analysis in Qiime

Hi all,

I'm trying to link a metagenomic analysis done with Qiime tools and a KO file obtained with Picrust. It's actually an editing text problem and
I guess someone here could help me.

I...
Forum: Bioinformatics 11-05-2012, 10:48 AM
Replies: 5
Views: 1,623
Posted By Giorgio C
Yes I see, as I told you before it depends...I...

Yes I see, as I told you before it depends...I personally sequenced in a 454flx+ 20 metagenome belong to 20 different subjects (both 16S and 18S) obtaining an avarage of 3000 high quality filtered...
Forum: Bioinformatics 11-04-2012, 01:40 PM
Replies: 5
Views: 1,623
Posted By Giorgio C
Hi Giorgia, wich type of illumina instrument...

Hi Giorgia,

wich type of illumina instrument do you have? How many different samples are you going to sequences? And just in general what's the question are you going to answer?

thanks,
Giorgio
Forum: Bioinformatics 11-03-2012, 10:31 PM
Replies: 5
Views: 1,623
Posted By Giorgio C
Bacterial Genome Comparison

Hi all,

After a metagenome 16S microbiome project, we have been interested to whole sequence a bacteria genome of our interest in 3 different subjects.
Now I have 3 whole genomes of the same...
Forum: Bioinformatics 10-23-2012, 02:06 PM
Replies: 9
Views: 3,762
Posted By Giorgio C
Thanks jordipt for your clarification...it's...

Thanks jordipt for your clarification...it's never late for good suggestions :)
Forum: Bioinformatics 07-18-2012, 04:35 AM
Replies: 10
Views: 2,354
Posted By Giorgio C
Yes infact, that was one of the thing I've...

Yes infact, that was one of the thing I've noticed, in the tab separeted file needs to add (\t) to the script.

By the way it works good !

Thank you again for your precious help.

Cheers,...
Forum: Bioinformatics 07-18-2012, 02:04 AM
Replies: 10
Views: 2,354
Posted By Giorgio C
Thank you Dariober, as you said it was a...

Thank you Dariober,

as you said it was a problem of some empty lines in the middle of the list that I did not see at first. Now it works good and however the 'skip blank script' version works...
Forum: Bioinformatics 07-17-2012, 06:31 AM
Replies: 10
Views: 2,354
Posted By Giorgio C
Thank you so much for your answer I've tried but...

Thank you so much for your answer I've tried but it give me an error:

Traceback (most recent call last):
File "script.py", line 9, in <module>
a= line.strip().split()[0]
IndexError: list...
Forum: Bioinformatics 07-17-2012, 02:38 AM
Replies: 10
Views: 2,354
Posted By Giorgio C
Scripting Help - Common Elements

Hi all,

I have a question hoping someone can help me.

I have a file with two columns A and B with a list of gene coordinates in each of them:

I'd like to write in another file every element...
Forum: Bioinformatics 03-30-2012, 07:47 AM
Replies: 6
Views: 1,523
Posted By Giorgio C
Yes, i'v just done it with mirDeep but being this...

Yes, i'v just done it with mirDeep but being this type of Orhichid not yet annotated i have a lot of no matching elements
Forum: Bioinformatics 03-30-2012, 07:39 AM
Replies: 6
Views: 1,523
Posted By Giorgio C
thank you very much for your fast reply. Is a...

thank you very much for your fast reply. Is a problem that most of the miRNAs are novel and have no match with the database ??
Forum: Bioinformatics 03-30-2012, 07:31 AM
Replies: 6
Views: 1,523
Posted By Giorgio C
There are two sets of miRNAs one coming out from...

There are two sets of miRNAs one coming out from a leaf and the other from the flower of the same Orchid. I have to know what are the differences between these two sets:
Elements in common and not....
Forum: Bioinformatics 03-30-2012, 04:02 AM
Replies: 6
Views: 1,523
Posted By Giorgio C
Comparison of two sets of miRNAs

Hi all,

i have two sets A and B of miRNAs. How i can make a comparison of them considering common elements and not ?

Is there any tool that makes this type of comparison ?

Thanks in advance...
Forum: Bioinformatics 03-21-2012, 05:21 AM
Replies: 9
Views: 3,762
Posted By Giorgio C
Thank you very much for your reply. You have been...

Thank you very much for your reply. You have been very helpful !!!
Forum: Bioinformatics 03-21-2012, 04:51 AM
Replies: 9
Views: 3,762
Posted By Giorgio C
Hmm.. i'm sorry but something is not clear to me;...

Hmm.. i'm sorry but something is not clear to me; If i have this situation:

- Number of total Bp sequenced = 7.114.424

- Number of reads = 354

- Length of targeted region = 225.000 bp

...
Forum: Bioinformatics 03-21-2012, 04:17 AM
Replies: 9
Views: 3,762
Posted By Giorgio C
or is : total number of bp obteined * total...

or is :

total number of bp obteined * total number of reads / length of targeted region ?
Showing results 1 to 25 of 89
Page 1 of 4 1 23 Last »

 


All times are GMT -8. The time now is 05:20 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO