SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 9 of 9
Search took 0.00 seconds.
Search: Posts Made By: dkainer
Forum: Bioinformatics 09-30-2015, 07:04 PM
Replies: 244
Views: 107,587
Posted By dkainer
i hadn't noticed the Seal command. Thanks for...

i hadn't noticed the Seal command. Thanks for responding so fast!

So i assume that if I were to input paired-end reads to Seal with a barcodes.fa as the ref, it would try and match the barcodes in...
Forum: Bioinformatics 09-30-2015, 06:36 PM
Replies: 244
Views: 107,587
Posted By dkainer
Brian, is there a way with the BB Suite to...

Brian,

is there a way with the BB Suite to demultiplex paired-end reads based on inline barcodes, like Flexbar does?

I can see it can be done one barcode at a time by outputting matching reads...
Forum: Illumina/Solexa 09-24-2015, 01:15 PM
Replies: 8
Views: 2,049
Posted By dkainer
SNPsaurus, that case looks pretty similar! ...

SNPsaurus, that case looks pretty similar!

The library is whole genome shotgun with P5 barcoded adapters: These adapters are of the form CTTTCCCTACACGACGCTCTTCCGATCT[AGGATG] where those last 6...
Forum: Illumina/Solexa 09-23-2015, 12:50 PM
Replies: 8
Views: 2,049
Posted By dkainer
no, i can see the barcode at the start of the raw...

no, i can see the barcode at the start of the raw R2 reads prior to trimming.

Let me rename things a little:

P5-barcode---read---barcode*-P5*-P7

Could the ---barcode*-P5*-P7 end of the...
Forum: Illumina/Solexa 09-23-2015, 12:27 PM
Replies: 8
Views: 2,049
Posted By dkainer
Hi dpryan, thanks for the quick reply. So...

Hi dpryan,

thanks for the quick reply. So let me try understand this. If we have fragments with:

P5-barcode-read-barcode-P5-P7

When the sequencer does the second read starting from the P7...
Forum: Bioinformatics 09-23-2015, 11:06 AM
Replies: 62
Views: 28,292
Posted By dkainer
Can Skewer do the requested operation (i.e. only...

Can Skewer do the requested operation (i.e. only taking a barcode from the start of the read) in paired end mode (PE)? or only in amplicon mode (AP)?
Forum: Illumina/Solexa 09-23-2015, 10:19 AM
Replies: 8
Views: 2,049
Posted By dkainer
inline barcodes appearing in reverse read of pair

Hi All,

I have Illumina 101bp paired-end data where the libraries were prepared with custom inline barcodes at the P5 end. So the first 6 bases of the R1 reads contain the barcode sequences for...
Forum: Bioinformatics 05-30-2015, 08:20 PM
Replies: 5
Views: 3,567
Posted By dkainer
Hi Brian thanks for the response. I have the...

Hi Brian

thanks for the response. I have the BBmap suite (very comprehensive by the way!). I merged overlapping pairs using BBmerge, so about 45% of my read pairs are now single end. Is it a good...
Forum: Bioinformatics 05-29-2015, 10:48 PM
Replies: 5
Views: 3,567
Posted By dkainer
Hi Ellenell did you ever figure out a good...

Hi Ellenell

did you ever figure out a good parameter set for BWA MEM (or any other aligner) for mapping with 3-4% divergence? I have a similar issue right now.
Showing results 1 to 9 of 9

 


All times are GMT -8. The time now is 08:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO