
Go Back   SEQanswers > Search Forums

Showing results 1 to 19 of 19
Search took 0.00 seconds.
Search: Posts Made By: rzeng
Forum: Bioinformatics 11-05-2013, 08:18 AM
Replies: 2
Views: 1,680
Posted By rzeng
BW. thank you for the information! Is -A:...

BW. thank you for the information!

Is -A: allelic depths which is the number of AD like example below that allelic depth is 0+2 =2 then I can set -A as a number based on the AD?

GT: AD:...
Forum: Bioinformatics 11-04-2013, 01:51 PM
Replies: 2
Views: 1,680
Posted By rzeng
variant filtering of mouse whole exome sequencing

hi, I have general question here about exome sequencing variant filtering.
I have generated mouse exome variants data from several samples using my pipeline including BWA alignment, samtools, picard...
Forum: Bioinformatics 11-04-2013, 11:28 AM
Replies: 3
Views: 3,667
Posted By rzeng
Hi, I may have the same problem as yours I...

Hi, I may have the same problem as yours

I use

[$ snps.annovar mm10db/ -protocol nonsyn_splicing,genomicSuperDups,SC_MOUSE_GENOMES.genotype.vcf,dominant -operation...
Forum: Bioinformatics 09-08-2013, 07:47 AM
Replies: 1
Views: 1,760
Posted By rzeng
I am running mouse whole exome sequence of DNA

I am running mouse whole exome sequence of DNA
Forum: Bioinformatics 09-07-2013, 07:05 PM
Replies: 1
Views: 1,760
Posted By rzeng
question about kmer content

HI, my kmer content report after I trim primer sequence was showed as followings, should I give up using these reads or continue trim them?

What situation that we should give up our reads for next...
Forum: Bioinformatics 09-05-2013, 10:43 AM
Replies: 8
Views: 3,551
Posted By rzeng
Thank you all the guys

Thank you all the guys
Forum: Bioinformatics 09-04-2013, 02:26 PM
Replies: 2
Views: 4,498
Posted By rzeng
BWA installation failed after "make" command in Linux

I am the first to install BWA and never use this software by commands of Linux.When I try to install BWA under bwa.0.7.5a, after I typed "make" it showed as follows:

gcc -g -Wall -O2...
Forum: Bioinformatics 09-04-2013, 09:42 AM
Replies: 1
Views: 1,143
Posted By rzeng
sorry i did not ask question clearly? it should...

sorry i did not ask question clearly? it should be Does BWA require pair-end reads with the same length?
Forum: Bioinformatics 09-04-2013, 09:34 AM
Replies: 1
Views: 1,143
Posted By rzeng
Mapping with BWA

My question is that when we do mapping with BWA, suppose we have pair-end reads, is it necessary that both forward and reverse reads with the same length? I ask this question because my forward and...
Forum: Bioinformatics 09-04-2013, 08:25 AM
Replies: 8
Views: 3,551
Posted By rzeng
No. I need to remove these reads which contain...

No. I need to remove these reads which contain this 50bp sequence noisy from my library before I map them with BWA
Forum: Bioinformatics 09-04-2013, 07:48 AM
Replies: 8
Views: 3,551
Posted By rzeng
My aim for above question is that I want to get...

My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account...
Forum: Bioinformatics 09-04-2013, 07:44 AM
Replies: 8
Views: 3,551
Posted By rzeng
how to delete the all fastq reads which includes a potential 50bp Illumina Single End


I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings


Forum: Bioinformatics 08-21-2013, 12:33 PM
Replies: 9
Views: 4,514
Posted By rzeng
GenoMax, I have splitted 400,000,000 tag...


I have splitted 400,000,000 tag reads and grouped them into 6 separate files using OUTER 6 different barcode sequences. I want to confirm with you that the next step is to use my own...
Forum: Bioinformatics 08-20-2013, 02:41 PM
Replies: 9
Views: 4,514
Posted By rzeng
Thanks GenoMax, That helps a lot! So my data...

Thanks GenoMax, That helps a lot!

So my data ID lines do NOT have tags on them, is that mean my data has not been processed by the Illumina pipeline?

Can I ask Illumina company to re-add tags...
Forum: Bioinformatics 08-20-2013, 09:42 AM
Replies: 9
Views: 4,514
Posted By rzeng
Thank you GenoMax, Pretty sad is, I took...

Thank you GenoMax,

Pretty sad is, I took over someone's project without know much about the background/information of the original data (I can not get contact with that guy who prepare these data...
Forum: Genomic Resequencing 08-19-2013, 12:53 PM
Replies: 0
Views: 1,652
Posted By rzeng
Questions for barcode file splitting, forward/reverse data sorting

HI, i am a pretty new for sequence analysis and totally new comer here. Anyone can help me? Very appreciate!!!

All I have are three fastq format separate raw data ( 40 million read sequences in...
Forum: Bioinformatics 08-19-2013, 12:35 PM
Replies: 9
Views: 4,514
Posted By rzeng
Reply GenoMax


Thanks much for your answer. However, my problem now is how to manage and separate the forward/reverse reads by using my separate barcode files (generated by data 2), considering more...
Forum: Bioinformatics 08-19-2013, 11:45 AM
Replies: 9
Views: 4,514
Posted By rzeng
Questions for barcode file splitting, forward/reverse data sorting

HI, i am a pretty new for sequence analysis and totally new comer here. My questions might be too basic for you to answer but it will help me start my sequence analysis work with a good beginning....
Forum: Illumina/Solexa 08-19-2013, 11:28 AM
Replies: 0
Views: 1,531
Posted By rzeng
Questions for barcode file splitting, forward/reverse data sorting and ....

HI, i am a pretty new for sequence analysis and totally new comer here. My questions might be too basic for you to answer but it will help me start my sequence analysis work with a good beginning....
Showing results 1 to 19 of 19


All times are GMT -8. The time now is 09:02 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO