Forum: Bioinformatics
03-15-2021, 01:19 PM
|
Replies: 3
Views: 2,007
So that's why my bam files look like garbled...
So that's why my bam files look like garbled nonsense when I open them in a text editor. They are in Latin! If only I'd been more cultured my research could have gone much faster if I could read...
|
Forum: General
02-24-2021, 11:39 AM
|
Replies: 2
Views: 259
|
Forum: Bioinformatics
01-25-2021, 01:17 PM
|
Replies: 4
Views: 776
It's treating each of your fastq files as an...
It's treating each of your fastq files as an independent sample, and making a sam file for each, which is what most people generally want to do. If you don't care about keeping them separate, you...
|
Forum: RNA Sequencing
09-16-2020, 01:55 PM
|
Replies: 6
Views: 2,037
You might try to look at some of the method/kit...
You might try to look at some of the method/kit comparison papers, or a paper describing a new library prep method. They often compare inter and intra assay performance of replicate inputs, usually...
|
Forum: Illumina/Solexa
09-03-2020, 09:11 AM
|
Replies: 8
Views: 3,534
|
Forum: Sample Prep / Library Generation
08-24-2020, 09:42 AM
|
Replies: 289
Views: 156,121
|
Forum: Sample Prep / Library Generation
08-14-2020, 09:32 AM
|
Replies: 1
Views: 1,465
You'd likely run into some nasty color balance...
You'd likely run into some nasty color balance issues just trying to add on an external adapter, and who knows what would happen during clustering with internal P5/P7.
Then you're especially stuck...
|
Forum: De novo discovery
06-04-2020, 03:12 PM
|
Replies: 2
Views: 2,980
Could you explain a little more about you're...
Could you explain a little more about you're intending to accomplish? As I understand it, you're performing paired end sequencing on a MiSeq. You then take the spent flowcell, and perform the...
|
Forum: Illumina/Solexa
03-26-2020, 10:58 AM
|
Replies: 2
Views: 2,706
It depends on your amplicon length and what...
It depends on your amplicon length and what you're trying to learn about it.
If it's shorter than ~500bp, you can amplify it directly with PCR primers with flanking Illumina adapter sequences, but...
|
Forum: RNA Sequencing
12-02-2019, 10:13 AM
|
Replies: 6
Views: 5,738
Color by first strand in pair and pick a...
Color by first strand in pair and pick a housekeeping gene (actin, GAPDH, etc). If you see roughly equal color mix, nondirectional. Nearly all the same color, directional with the protocol...
|
Forum: RNA Sequencing
11-21-2019, 08:36 AM
|
Replies: 4
Views: 3,280
|
Forum: RNA Sequencing
11-20-2019, 02:29 PM
|
Replies: 4
Views: 3,280
I take it these are NextSeq or NovaSeq?
This...
I take it these are NextSeq or NovaSeq?
This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no...
|
Forum: Sample Prep / Library Generation
10-08-2019, 02:47 PM
|
Replies: 3
Views: 1,393
By bad annotation, I mean that the...
By bad annotation, I mean that the polyadenylation sites in RefSeq/Gencode are often incorrect, which can make it difficult to amplify the 3'UTR (Refseq in particular tends to choose the longest 3'...
|
Forum: Sample Prep / Library Generation
10-07-2019, 03:33 PM
|
Replies: 3
Views: 1,393
1. Sure, you can swap in different length RT...
1. Sure, you can swap in different length RT primers without a noticeable impact on performance
2. SSII is definitely better than SSIII, but I don't know about IV
3. I personally like Takara's...
|
Forum: General
10-01-2019, 12:57 PM
|
Replies: 6
Views: 3,363
|
Forum: General
09-30-2019, 11:48 AM
|
Replies: 6
Views: 3,363
Yes, but with levels of difficulty ranging from...
Yes, but with levels of difficulty ranging from trivial to very difficult. If they're for an NGS related application, there's a good chance they're just common primers you can pick from a catalogue...
|
Forum: Ion Torrent
08-02-2019, 08:22 AM
|
Replies: 19
Views: 10,177
|
Forum: Sample Prep / Library Generation
05-22-2019, 09:19 AM
|
Replies: 2
Views: 1,647
|
Forum: General
05-14-2019, 04:05 PM
|
Replies: 1
Views: 2,506
Well that sure cleared up how to translate from...
Well that sure cleared up how to translate from one programming language from another...
Your PI probably wants it in Perl because they can read/write Perl, but not Python and want to double check...
|
Forum: Sample Prep / Library Generation
04-05-2019, 01:41 PM
|
Replies: 3
Views: 895
Take a page out of old school RACE (or...
Take a page out of old school RACE (or Tang/Quartz scRNA-Seq for a more modern example). Add a homopolymer tail using TdT, perform second strand with a complementary primer also with a defined tag,...
|
Forum: Sample Prep / Library Generation
04-05-2019, 01:21 PM
|
Replies: 10
Views: 2,110
|
Forum: Bioinformatics
04-01-2019, 11:22 AM
|
Replies: 7
Views: 1,204
That sequence isn't derived from the fragment...
That sequence isn't derived from the fragment you're trying to sequence. 100% of it was chemically synthesized by your oligo synthesis company. It match close enough to your insert of interest to...
|
Forum: Sample Prep / Library Generation
03-01-2019, 09:31 AM
|
Replies: 10
Views: 2,110
|
Forum: Sample Prep / Library Generation
03-01-2019, 09:10 AM
|
Replies: 10
Views: 2,110
|
Forum: RNA Sequencing
02-28-2019, 04:51 PM
|
Replies: 2
Views: 2,361
|