Forum: Bioinformatics
08-02-2017, 07:40 AM
|
Replies: 0
Views: 1,253
|
Forum: Bioinformatics
01-24-2017, 10:49 PM
|
Replies: 3
Views: 4,009
Alignment of small RNA data
I was recently at a meeting about RNA-seq in general, and the topic of small RNA-seq came up, something with which I'm quite unfamiliar. The discussions were interesting, but seeing as I didn't know...
|
Forum: Bioinformatics
11-17-2016, 04:52 AM
|
Replies: 7
Views: 1,848
Thank you for the response! What would be the...
Thank you for the response! What would be the longest gene in base pairs you feel could be sequenced, then? The platform that is being discussed gives 350 bp reads, if I heard them correctly.
|
Forum: Bioinformatics
11-16-2016, 11:20 PM
|
Replies: 7
Views: 1,848
Questions about sequencing a selection library
(Sorry for the long thread; complicated and interesting experiment that needs some explaining. Thanks for reading!)
A couple of colleagues have recently come to the conclusion that they might have...
|
Forum: Bioinformatics
09-11-2016, 10:40 PM
|
Replies: 1
Views: 1,647
|
Forum: Bioinformatics
09-05-2016, 06:46 AM
|
Replies: 1
Views: 1,647
|
Forum: Bioinformatics
04-25-2016, 09:31 AM
|
Replies: 21
Views: 3,637
|
Forum: Bioinformatics
04-24-2016, 02:50 AM
|
Replies: 21
Views: 3,637
I ran fastqQvalidator on the first of the raw...
I ran fastqQvalidator on the first of the raw files I got, and it said this:
ERROR on Line 281: Repeated Sequence Identifier: HWUSI-EAS101E:4:FC:2:1:1055:6024_1:N:0:/1 at Lines 277 and 281
ERROR...
|
Forum: Bioinformatics
04-23-2016, 05:10 AM
|
Replies: 21
Views: 3,637
I do get something like this:
...
I do get something like this:
@HWUSI-EAS101E:4:FC:2:1:1029:10648_1:N:0:/1
CGACAGCTCCTCAACTGCCTCCATGTCATCACCCTGTACAACCGCATCAAG
+
HDH:HGHHHHHHHGHHGHHHHHHHHHHHHHHEDFHHHHHHHHHDGHGHGHH
--...
|
Forum: Bioinformatics
04-23-2016, 03:27 AM
|
Replies: 21
Views: 3,637
Well, I can't get repair.sh to run, because...
Well, I can't get repair.sh to run, because apparently some of the reads and different read and quality lengths, so I guess something happened in the code you gave. I'm not sure what the second grep...
|
Forum: Bioinformatics
04-22-2016, 01:12 PM
|
Replies: 21
Views: 3,637
|
Forum: Bioinformatics
04-22-2016, 07:59 AM
|
Replies: 21
Views: 3,637
|
Forum: Bioinformatics
04-22-2016, 03:32 AM
|
Replies: 21
Views: 3,637
Yes indeed, they don't seem to match either...
Yes indeed, they don't seem to match either format... I'm quite unsure as to what parts I should change, and how. Is it the "_2" part in reads with "/1" at the end, or other things as well? For...
|
Forum: Bioinformatics
04-21-2016, 10:21 PM
|
Replies: 21
Views: 3,637
First 5 read pairs from each file:
R1: ...
First 5 read pairs from each file:
R1:
@HWUSI-EAS101E:4:FC:2:1:1028:9892_2:N:0:/1
CCTTGCTCAGCTCACACCGCAGCGTGGCCGTGGCCCCTTCTGTGGCCTCCT
+
IIIIIFIIHIGHIFIIGDIIIIIGIIGIEIEHH@FEE+CC2;5;;;?94?5...
|
Forum: Bioinformatics
04-21-2016, 01:59 AM
|
Replies: 21
Views: 3,637
Weird Cufflinks results from odd alignments
I recently ran some collaborative FASTQ files through my standard Tophat/Cufflinks pipeline, and got some really weird results. The Cufflinks yielded mostly zero-FPKM genes, which started me on this...
|
Forum: Bioinformatics
02-08-2016, 09:21 PM
|
Replies: 13
Views: 3,102
|
Forum: Bioinformatics
02-08-2016, 04:21 AM
|
Replies: 13
Views: 3,102
|
Forum: Bioinformatics
02-08-2016, 03:11 AM
|
Replies: 13
Views: 3,102
I'm using the HaplotypeCaller as per the Best...
I'm using the HaplotypeCaller as per the Best Practices. So, you're saying that I shouldn't merge my replicate data, at all? If so, how would you handle different variant calls between the replicates...
|
Forum: Bioinformatics
02-08-2016, 02:55 AM
|
Replies: 13
Views: 3,102
Thanks for your answer! I have biological...
Thanks for your answer! I have biological replicates from cell lines (so normal considerations as to what extent biological replicates for cell lines are "biological" apply), with a single library...
|
Forum: Bioinformatics
02-07-2016, 10:06 PM
|
Replies: 13
Views: 3,102
|
Forum: Bioinformatics
12-22-2015, 03:09 AM
|
Replies: 3
Views: 1,265
Ah, interesting... I have never done a de novo...
Ah, interesting... I have never done a de novo assembly before, either on genomic or transcriptome level. I assume you're advicing I do it on the genomic level, or? Could you point me towards some...
|
Forum: Bioinformatics
12-21-2015, 11:58 PM
|
Replies: 3
Views: 1,265
Finding the genomic location of an insert
Is there some way to use RNA-seq and/or whole genome sequencing data (I have both for the relevant samples) to find the genomic location of an insert with an unknown location? The insert itself is of...
|
Forum: Bioinformatics
11-11-2015, 07:12 AM
|
Replies: 0
Views: 900
|
Forum: Bioinformatics
10-22-2015, 02:54 AM
|
Replies: 1
Views: 910
NGS data directory structures
After a recent influx of new data, I am beginning to doubt the way that I previously stored my data (both raw and processed), so I figured I might as well ask on here what people's directory...
|
Forum: Bioinformatics
10-01-2015, 03:53 AM
|
Replies: 17
Views: 3,244
Actually for this data (i.e. RNA-seq) the...
Actually for this data (i.e. RNA-seq) the sequence shouldn't be there, so aligning few reads is actually good for me! I will run through the workflow again with another k-mer, maybe 35 or 50?
I...
|