SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 6 of 6
Search took 0.00 seconds.
Search: Posts Made By: lvxiaobao
Forum: Literature Watch 08-02-2010, 12:48 AM
Replies: 1
Views: 1,337
Posted By lvxiaobao
thanks, i'll have a try

thanks, i'll have a try
Forum: Sample Prep / Library Generation 03-22-2010, 11:31 PM
Replies: 4
Views: 11,413
Posted By lvxiaobao
Thanks a lot! Though i can't understand it...

Thanks a lot! Though i can't understand it exactly i think it's a really good post. By the way, can somebody explan the mechanism of t4 dna ligase? Thanks!
Forum: Illumina/Solexa 01-19-2010, 06:47 PM
Replies: 5
Views: 2,668
Posted By lvxiaobao
yes, it,s what i mean. i read the paper...

yes, it,s what i mean.
i read the paper "Accurate Whole Human Genome Sequencing using Reversible Terminator Chemistry" of Bentley and found he use the same PE1 adapter in both single read and paired...
Forum: Illumina/Solexa 01-19-2010, 01:34 AM
Replies: 5
Views: 2,668
Posted By lvxiaobao
HELP:difference between SE1 and PE1 adapter

SE1 5'-ACACTCTTTCCCTACACGACC-TCTTCCGATC*T-3'
PE1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3',
and
SE2 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
PE2...
Forum: Bioinformatics 12-22-2009, 06:59 PM
Replies: 236
Views: 504,288
Posted By lvxiaobao
good thing thanks

good thing thanks
Forum: Sample Prep / Library Generation 12-22-2009, 06:50 PM
Replies: 1
Views: 1,747
Posted By lvxiaobao
help: time of adapter ligation

hello everyone , i'am sample prepation of mRNA, and i have a question about adapter ligation to the dsCDNA:
the protocol of illuminate write: incubate the sample at room temperature for 15 minutes....
Showing results 1 to 6 of 6

 


All times are GMT -8. The time now is 10:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO