SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 81
Search took 0.01 seconds.
Search: Posts Made By: super0925
Forum: RNA Sequencing 10-28-2014, 04:32 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D after alignment. (1)I found that some...

Hi D after alignment.
(1)I found that some mapped reads in the SAM file
are '23M1I25M1I15M1I10M' or '21M1I13M1I8M2I8M' (CIGAR). are these normal?
(2) After alignment, we could IGV to visualize...
Forum: RNA Sequencing 10-13-2014, 06:55 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D Helpful! And 1.Before trimming, the...

Hi D
Helpful! And
1.Before trimming, the quality score means Phred scores. So do you mean I don't need to trim too much (so far I only remove the very short reads)
2. After mapping, for the...
Forum: RNA Sequencing 10-13-2014, 05:34 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D, I remember that clearly that you told me in...

Hi D, I remember that clearly that you told me in RNA-Seq, bofore doing the mapping we need 'gentle' trimming. So I have trimmed the very short reads, but is that essential to remove the low quality...
Forum: RNA Sequencing 10-08-2014, 03:04 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D, useful! For my second question, is...

Thank you D, useful!
For my second question, is it could be happen that the some genes are predicted as logFC positive in RPKM based pipeline (Cuffdiff) while predicted as logFC negative in count...
Forum: RNA Sequencing 10-07-2014, 07:12 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D, very useful. We extracted the RNAs...

Thank you D, very useful.
We extracted the RNAs from the cells using tryzol method followed by a clean up using RNAeasy Mini kit. And then remove most of the RNA shorter than 200 nts in length....
Forum: RNA Sequencing 10-07-2014, 04:09 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D, Just two questions. 1)I am doing...

Hi D,
Just two questions.
1)I am doing RNA-Seq analysis (reads mapped to human genome) and want to find significant Differential expressed human genes, but I also find there is some reads counts...
Forum: RNA Sequencing 08-29-2014, 04:49 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D. Very useful! I got it:) So do you...

Thank you D. Very useful! I got it:)
So do you think it is due to I didn't do Cufflinks? Cause I omit this steps that I don't need find new genes and assemble the transcripts. And for the counts...
Forum: RNA Sequencing 08-28-2014, 11:25 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D A quick question I have shown that my...

Hi D
A quick question
I have shown that my results comparison among the pipelines to you before.

tophat-bam-cuffdiff2 (I don't use cufflinks cause I don't need to finid the new genes)...
Forum: RNA Sequencing 08-13-2014, 11:46 PM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D. So from the MDS and MA plots are...

Thank you D. So from the MDS and MA plots are looked like OK (cause they are not totally separate between two groups)?
Forum: RNA Sequencing 08-13-2014, 06:41 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi teacher, another question again. I am...

Hi teacher, another question again.
I am analysising 6 samples in 2 conditions.
From Cuffdiff2, I got ~700 DE genes (default is Q <0.05 , you got it)
But if I use edgeR and DESeq2, I didn't find...
Forum: RNA Sequencing 07-31-2014, 05:28 AM
Replies: 192
Views: 46,557
Posted By super0925
Sorry D, if I add the "-x" , I still get the same...

Sorry D, if I add the "-x" , I still get the same error... T__T
Forum: RNA Sequencing 07-29-2014, 06:22 AM
Replies: 192
Views: 46,557
Posted By super0925
Hello D, Sorry to trouble you again in this...

Hello D,
Sorry to trouble you again in this issue.
If I want to see whether a sequence (supposed named "GQ2") is expressed in bovine cells. I followed the solution in our last discussion: 'firstly...
Forum: RNA Sequencing 07-17-2014, 01:38 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you soooo much! You are not only my...

Thank you soooo much! You are not only my consultant, but also my teacher :)
I will try to do it.
Forum: RNA Sequencing 07-16-2014, 06:49 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D I have two samples (i.e. two .fastq files)...

Hi D
I have two samples (i.e. two .fastq files) from bovine. If I want to see whether a sequence (supposed named "GQ2") is expressed in bovine cells. (I have got the FASTA of this sequence) The...
Forum: RNA Sequencing 07-15-2014, 12:59 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you, It is what I want. In FactoMineR...

Thank you, It is what I want.
In FactoMineR function, I have 2 questions:
I found that in PCA function there are quanti.sup, quali.sup parameters, what are these?
Could you pls give me some...
Forum: RNA Sequencing 07-14-2014, 09:48 AM
Replies: 192
Views: 46,557
Posted By super0925
How could I know which sample is outlier? The...

How could I know which sample is outlier? The heatmap and PCA plot don't give the subtitle or label. Thx!
Forum: RNA Sequencing 07-14-2014, 07:03 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D Another question, When I use DESeq2 on...

Hi D
Another question,
When I use DESeq2 on the one of my data. The PCA plot and heatmap are like those which listed in the attached figure.
As you see , I have 6 samples , but it is not...
Forum: RNA Sequencing 07-03-2014, 03:03 AM
Replies: 192
Views: 46,557
Posted By super0925
Q1: I am sorry I don't get totally what you...

Q1:
I am sorry I don't get totally what you mean.
I have an indenpedent fasta file like
>Luciferase
ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGA
Do you mean add this to the...
Forum: RNA Sequencing 07-03-2014, 01:38 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D! My questions: Q1:How to do...

Thank you D!
My questions:

Q1:How to do that? So far I only have the luciferase coding sequence in fasta format. The specie is human.

Q2:So far I use Tophat mapping with default parameter (on...
Forum: RNA Sequencing 07-02-2014, 12:36 PM
Replies: 192
Views: 46,557
Posted By super0925
Hi another quick question, suppose my library...

Hi another quick question, suppose my library contains 300 human genes and luciferase mRNA, could I check the expression level of this luciferase ? Thank you!
Forum: RNA Sequencing 06-19-2014, 04:57 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D, This is very useful. My supervisor...

Thank you D,
This is very useful. My supervisor asked me for statistic of how many reads counts are partly or totally overlap with introns in each genes.
sth. like
gene1 counts 200 counts overlap...
Forum: RNA Sequencing 06-19-2014, 12:50 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D. 1. I will not remove 'partly...

Thank you D.
1.
I will not remove 'partly overlap' intron reads but if I want to know the propotion of these 'partly overlap' intron reads, how could I do that?

2.
for the 'full overlap'...
Forum: RNA Sequencing 06-18-2014, 08:51 AM
Replies: 192
Views: 46,557
Posted By super0925
Thank you D. I got it. Another question,...

Thank you D.
I got it.
Another question, suppose a gene has 200 reads counts mapped, how many reads out of 200 reads has the overlap with introns? How do I know that? Do I need to remove these...
Forum: RNA Sequencing 06-17-2014, 01:37 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi D Just a quick question about Cuffdiff. As...

Hi D
Just a quick question about Cuffdiff.
As we know we selected the significant DE genes in Cuffdiff by FDR Q-value< 0.05. But if I still think it is too liberal, could we have more conservative...
Forum: RNA Sequencing 06-03-2014, 02:35 AM
Replies: 192
Views: 46,557
Posted By super0925
Hi Devon Thank you for your explantion. (1)My...

Hi Devon
Thank you for your explantion.
(1)My unstanding is I don't need to consider about the genes with p-value or adj-pvalue are set to 'NA'. All of them could be filtered by package. Am I...
Showing results 1 to 25 of 81

 


All times are GMT -8. The time now is 07:42 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO