SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 21 of 21
Search took 0.00 seconds.
Search: Posts Made By: jyli
Forum: Bioinformatics 05-18-2011, 04:10 AM
Replies: 42
Views: 98,489
Posted By jyli
I posted this on another thread, but -r STR...

I posted this on another thread, but

-r STR read group header line such as `@RG\tID:foo\tSM:bar'[null]

gave me error: " malformated @RG line"

Can you please help?
Forum: Bioinformatics 05-17-2011, 11:46 AM
Replies: 3
Views: 2,405
Posted By jyli
Actually, I found the piece of C code in bwa,...

Actually, I found the piece of C code in bwa, BUT, I never programmed in "C" :confused:

while ((c = getopt(argc, argv, "a:o:sPn:N:c:f:Ar:")) >= 0) {
switch (c) {
case 'r':
if...
Forum: Bioinformatics 05-17-2011, 11:33 AM
Replies: 3
Views: 2,405
Posted By jyli
Hi, there I tried similar thing, but it gave...

Hi, there

I tried similar thing, but it gave me different errors:

bwa sampe -P -a 334 -r '@RG\tID:dodrp445981_1_2_13052011\tSM:dodrp445981\tLB:ga\tPL:Illumina'

Error:

malformated @RG...
Forum: Bioinformatics 04-14-2011, 10:14 AM
Replies: 42
Views: 98,489
Posted By jyli
Were you ever be able to figure it out (with the...

Were you ever be able to figure it out (with the already a merged bam file)?
Forum: Bioinformatics 06-28-2010, 09:59 AM
Replies: 2
Views: 1,391
Posted By jyli
My version of BWA was 0.5.7

My version of BWA was 0.5.7
Forum: Bioinformatics 06-28-2010, 09:58 AM
Replies: 2
Views: 1,391
Posted By jyli
BWA error

Dear all

I am having a very weird error when trying to build the BWA index for hg18 genome (masked). Do you have any experiences or idea? Thanks.


[jyli@lbg-comp3 maskedHG18]$ bwa index...
Forum: Bioinformatics 03-16-2010, 06:13 AM
Replies: 0
Views: 1,056
Posted By jyli
BWA question

Dear all,

We are using BWA (0.5.7 ) to align Illumina read to refseq database, however we encountered some strange results see following:

This is from a SE lane mapped against our hg19 custom...
Forum: Bioinformatics 03-05-2010, 07:06 AM
Replies: 2
Views: 1,241
Posted By jyli
Thanks for your attention! And, it solved the...

Thanks for your attention! And, it solved the problem that I have.
Forum: Bioinformatics 03-04-2010, 07:39 AM
Replies: 2
Views: 1,241
Posted By jyli
BWA Segmantation fault

Dear all,

I have recently encountered a weird error with BWA (0.4.5)alignment. It runs fine to generate .sai file, but when I ran "bwa samse", I got "segmentation fault". The weird thing is...
Forum: Bioinformatics 10-29-2009, 12:09 PM
Replies: 1
Views: 1,690
Posted By jyli
tophat unmapped reads

Hi,

I was planning to extract the unmapped short reads when running tophat, where are those unmapped reads stored? is there any easy way to do this?
Forum: Bioinformatics 10-14-2009, 06:01 AM
Replies: 2
Views: 1,195
Posted By jyli
Thank you so much, it worked out properly!

Thank you so much, it worked out properly!
Forum: Bioinformatics 10-13-2009, 12:35 PM
Replies: 2
Views: 1,195
Posted By jyli
tophat on paired files

Dear all,

I am using tophat and ran into a simple error. When I put in more pairs in the command, it failed complaining not being able to open the files.

Any comment is appreciated...

What...
Forum: Bioinformatics 10-13-2009, 11:06 AM
Replies: 6
Views: 2,945
Posted By jyli
Your command looks good to me, this is the log I...

Your command looks good to me, this is the log I got:

[Thu Sep 17 15:47:31 2009] Beginning TopHat run (v1.0.10)
-----------------------------------------------
[Thu Sep 17 15:47:31 2009]...
Forum: Bioinformatics 10-12-2009, 11:20 AM
Replies: 9
Views: 2,746
Posted By jyli
So, it is memory usage problem then? Interesting...

So, it is memory usage problem then? Interesting though as the developer claimed that we do NOT need to split file, which I always did in the past.
Forum: Bioinformatics 09-01-2009, 04:40 AM
Replies: 9
Views: 2,746
Posted By jyli
MAQ error

I am using MAQ 0.7.1 and I recently encountered a weird errors:

-- maq-0.7.1
[ma_load_reads] loading reads...
[ma_load_reads] set length of the first read as 35.
[ma_load_reads] 17547636*2...
Forum: Bioinformatics 02-16-2009, 08:04 AM
Replies: 2
Views: 2,529
Posted By jyli
MAQ error

When I tried to run MAQ for alignment, I ran into errors like following:

maq: match.cc:557: int ma_match(int, char**): Assertion `fp_bfa' failed.
/ifs1/home/jyli/.lsbatch/1234799677.211076: line...
Forum: Bioinformatics 02-03-2009, 09:54 AM
Replies: 0
Views: 1,316
Posted By jyli
MAQ - segmentation error

Dear all,

I downloaded human transcripts from Ensemble. After I unzipped the file, I tried to use maq fasta2bfa command. Then I ran into an error "Segmentation error". Has anybody encountered such...
Forum: Illumina/Solexa 01-26-2009, 09:43 AM
Replies: 0
Views: 1,208
Posted By jyli
MAQ command

Hi all-

I have a question about MAQ software. At the website, http://maq.sourceforge.net/maq-man.shtml, one of the key commands listed was maq MATCH -param, etc. However in their manual...
Forum: Illumina/Solexa 01-12-2009, 09:31 AM
Replies: 20
Views: 7,895
Posted By jyli
Pingh- Can you please advise where I can get...

Pingh-

Can you please advise where I can get Illumina DpnII tag library?

Thanks.

Jianying
Forum: Introductions 01-06-2009, 04:47 AM
Replies: 373
Views: 110,245
Posted By jyli
Happy New Year to you all! I am new to this...

Happy New Year to you all!

I am new to this field, while I was working with Sanger's platform in the past. I am learning and hope to learn from you all.

Thanks for the initiative for getting...
Forum: Bioinformatics 11-13-2008, 12:07 PM
Replies: 513
Views: 191,831
Posted By jyli
Memory requirement on a window 32x

I tried to test human index downloaded from recommended site with the command

bowtie -c h_sapiens_asm ATTCAGTAGGTACTATAAATGGCCGAT

then, I got error:

Out of memory allocating ebwt[] in...
Showing results 1 to 21 of 21

 


All times are GMT -8. The time now is 10:42 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO