SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 86
Search took 0.00 seconds.
Search: Posts Made By: ErikFas
Forum: Bioinformatics 08-02-2017, 08:40 AM
Replies: 0
Views: 1,212
Posted By ErikFas
Choosing experimental models for three-condition DE analysis

I recently got a new project to work on regarding differential expression analysis of RNA-seq data, and it's slightly different to what I've done previously in that it has three conditions, rather...
Forum: Bioinformatics 01-24-2017, 11:49 PM
Replies: 3
Views: 3,787
Posted By ErikFas
Alignment of small RNA data

I was recently at a meeting about RNA-seq in general, and the topic of small RNA-seq came up, something with which I'm quite unfamiliar. The discussions were interesting, but seeing as I didn't know...
Forum: Bioinformatics 11-17-2016, 05:52 AM
Replies: 7
Views: 1,780
Posted By ErikFas
Thank you for the response! What would be the...

Thank you for the response! What would be the longest gene in base pairs you feel could be sequenced, then? The platform that is being discussed gives 350 bp reads, if I heard them correctly.
Forum: Bioinformatics 11-17-2016, 12:20 AM
Replies: 7
Views: 1,780
Posted By ErikFas
Questions about sequencing a selection library

(Sorry for the long thread; complicated and interesting experiment that needs some explaining. Thanks for reading!)

A couple of colleagues have recently come to the conclusion that they might have...
Forum: Bioinformatics 09-11-2016, 11:40 PM
Replies: 1
Views: 1,584
Posted By ErikFas
I managed to solve it myself, so I'm posting the...

I managed to solve it myself, so I'm posting the solution if anybody else happens upon the same problem. I first used the NCBI Entrez Direct CLI (http://www.ncbi.nlm.nih.gov/books/NBK179288/) to...
Forum: Bioinformatics 09-05-2016, 07:46 AM
Replies: 1
Views: 1,584
Posted By ErikFas
Searching, parsing and working with large GEO queries

Ok, so I'm about to start the largest project I've undertaken, in terms of data handling and analysis. In short, the project is about finding public datasets available at the Gene Expression Omnibus...
Forum: Bioinformatics 04-25-2016, 10:31 AM
Replies: 21
Views: 3,500
Posted By ErikFas
I've just spoken to my PI about this problem, and...

I've just spoken to my PI about this problem, and we've chosen to not continue with this mucking about with weird FASTQ files in lieu of waiting for the actual raw data and doing more fruitful...
Forum: Bioinformatics 04-24-2016, 03:50 AM
Replies: 21
Views: 3,500
Posted By ErikFas
I ran fastqQvalidator on the first of the raw...

I ran fastqQvalidator on the first of the raw files I got, and it said this:

ERROR on Line 281: Repeated Sequence Identifier: HWUSI-EAS101E:4:FC:2:1:1055:6024_1:N:0:/1 at Lines 277 and 281
ERROR...
Forum: Bioinformatics 04-23-2016, 06:10 AM
Replies: 21
Views: 3,500
Posted By ErikFas
I do get something like this: ...

I do get something like this:

@HWUSI-EAS101E:4:FC:2:1:1029:10648_1:N:0:/1
CGACAGCTCCTCAACTGCCTCCATGTCATCACCCTGTACAACCGCATCAAG
+
HDH:HGHHHHHHHGHHGHHHHHHHHHHHHHHEDFHHHHHHHHHDGHGHGHH
--...
Forum: Bioinformatics 04-23-2016, 04:27 AM
Replies: 21
Views: 3,500
Posted By ErikFas
Well, I can't get repair.sh to run, because...

Well, I can't get repair.sh to run, because apparently some of the reads and different read and quality lengths, so I guess something happened in the code you gave. I'm not sure what the second grep...
Forum: Bioinformatics 04-22-2016, 02:12 PM
Replies: 21
Views: 3,500
Posted By ErikFas
Yes, that's what I've trying to do just after I...

Yes, that's what I've trying to do just after I got the first Cufflinks results, actually, but since as the person whom I'm in contact with isn't actually a bioinformatician and the person...
Forum: Bioinformatics 04-22-2016, 08:59 AM
Replies: 21
Views: 3,500
Posted By ErikFas
Yeah, they do seem identical... I didn't catch it...

Yeah, they do seem identical... I didn't catch it either, so I did what Genomax said and I'm currently aligning the results - I guess we'll see what happens! But, what if they are identical?
Forum: Bioinformatics 04-22-2016, 04:32 AM
Replies: 21
Views: 3,500
Posted By ErikFas
Yes indeed, they don't seem to match either...

Yes indeed, they don't seem to match either format... I'm quite unsure as to what parts I should change, and how. Is it the "_2" part in reads with "/1" at the end, or other things as well? For...
Forum: Bioinformatics 04-21-2016, 11:21 PM
Replies: 21
Views: 3,500
Posted By ErikFas
First 5 read pairs from each file: R1: ...

First 5 read pairs from each file:

R1:
@HWUSI-EAS101E:4:FC:2:1:1028:9892_2:N:0:/1
CCTTGCTCAGCTCACACCGCAGCGTGGCCGTGGCCCCTTCTGTGGCCTCCT
+
IIIIIFIIHIGHIFIIGDIIIIIGIIGIEIEHH@FEE+CC2;5;;;?94?5...
Forum: Bioinformatics 04-21-2016, 02:59 AM
Replies: 21
Views: 3,500
Posted By ErikFas
Weird Cufflinks results from odd alignments

I recently ran some collaborative FASTQ files through my standard Tophat/Cufflinks pipeline, and got some really weird results. The Cufflinks yielded mostly zero-FPKM genes, which started me on this...
Forum: Bioinformatics 02-08-2016, 10:21 PM
Replies: 13
Views: 2,985
Posted By ErikFas
I have around 30 million reads per sample, so I'd...

I have around 30 million reads per sample, so I'd think that's coverage enough, at least for most other RNA-seq applications... And probably for variants calls as well, or?
Forum: Bioinformatics 02-08-2016, 05:21 AM
Replies: 13
Views: 2,985
Posted By ErikFas
Replicates for DE-analysis and other downstream...

Replicates for DE-analysis and other downstream analyses is of course important, but I was told that for variant calling it might be statistically helpful to regard them as the same sample (i.e....
Forum: Bioinformatics 02-08-2016, 04:11 AM
Replies: 13
Views: 2,985
Posted By ErikFas
I'm using the HaplotypeCaller as per the Best...

I'm using the HaplotypeCaller as per the Best Practices. So, you're saying that I shouldn't merge my replicate data, at all? If so, how would you handle different variant calls between the replicates...
Forum: Bioinformatics 02-08-2016, 03:55 AM
Replies: 13
Views: 2,985
Posted By ErikFas
Thanks for your answer! I have biological...

Thanks for your answer! I have biological replicates from cell lines (so normal considerations as to what extent biological replicates for cell lines are "biological" apply), with a single library...
Forum: Bioinformatics 02-07-2016, 11:06 PM
Replies: 13
Views: 2,985
Posted By ErikFas
RNA-seq variant calling and merging replicate data

I recently started to do a bit of RNA-seq variant calling (using the GATK Best Practices pipeline), but I'm wondering as to how I should handle replicate data. If I have three replicates for a...
Forum: Bioinformatics 12-22-2015, 04:09 AM
Replies: 3
Views: 1,213
Posted By ErikFas
Ah, interesting... I have never done a de novo...

Ah, interesting... I have never done a de novo assembly before, either on genomic or transcriptome level. I assume you're advicing I do it on the genomic level, or? Could you point me towards some...
Forum: Bioinformatics 12-22-2015, 12:58 AM
Replies: 3
Views: 1,213
Posted By ErikFas
Finding the genomic location of an insert

Is there some way to use RNA-seq and/or whole genome sequencing data (I have both for the relevant samples) to find the genomic location of an insert with an unknown location? The insert itself is of...
Forum: Bioinformatics 11-11-2015, 08:12 AM
Replies: 0
Views: 873
Posted By ErikFas
How to deal with non-reference genes in sequencing data

I have two cell lines, one of which has a transfected, non-reference antibiotic resistance gene. In one adjacent gene (which exist in both cell lines), there are two possible heterozygous SNPs. The...
Forum: Bioinformatics 10-22-2015, 03:54 AM
Replies: 1
Views: 881
Posted By ErikFas
NGS data directory structures

After a recent influx of new data, I am beginning to doubt the way that I previously stored my data (both raw and processed), so I figured I might as well ask on here what people's directory...
Forum: Bioinformatics 10-01-2015, 04:53 AM
Replies: 17
Views: 3,142
Posted By ErikFas
Actually for this data (i.e. RNA-seq) the...

Actually for this data (i.e. RNA-seq) the sequence shouldn't be there, so aligning few reads is actually good for me! I will run through the workflow again with another k-mer, maybe 35 or 50?

I...
Showing results 1 to 25 of 86

 


All times are GMT -8. The time now is 07:34 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO