SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 3 1 23
Showing results 1 to 25 of 71
Search took 0.01 seconds. Search: Posts Made By: jdk787
Forum: Sample Prep / Library Generation 10-02-2020, 07:38 PM
Replies: 5
Views: 1,600
Posted By jdk787
If you're using Nanodrop on PCR products before...

If you're using Nanodrop on PCR products before cleanup, the "high concentration" you saw was likely just unincorporated nucleotides in the PCR mix, so that isn't useful.

If you run your cleaned...
Forum: Sample Prep / Library Generation 10-01-2020, 05:29 AM
Replies: 3
Views: 1,242
Posted By jdk787
As long as the qPCR results are good those...

As long as the qPCR results are good those libraries should be fine to sequence.
Forum: Bioinformatics 04-02-2020, 12:39 PM
Replies: 19
Views: 1,718
Posted By jdk787
For MiSeq data, MiSeq Reporter and I think...

For MiSeq data, MiSeq Reporter and I think BaseSpace don't include the index sequence in the headers.
Forum: Bioinformatics 04-02-2020, 10:03 AM
Replies: 19
Views: 1,718
Posted By jdk787
If you look at the DemultiplexSummaryF1L1.txt it...

If you look at the DemultiplexSummaryF1L1.txt it will tell you what barcodes were used on the run if the demultiplexing worked.

It's located at
<run folder>\Data\Intensities\BaseCalls\Alignment
Forum: Illumina/Solexa 03-05-2020, 05:02 PM
Replies: 2
Views: 1,420
Posted By jdk787
Correct, I think 10X says to do 28 cycles for R1,...

Correct, I think 10X says to do 28 cycles for R1, then 8 for i7, then 90 or however many cycles you have left for the insert read in R2
Forum: Sample Prep / Library Generation 10-30-2019, 03:22 PM
Replies: 2
Views: 1,827
Posted By jdk787
I have seen many PCR Free protocols recommend two...

I have seen many PCR Free protocols recommend two cleanups to be sure to get rid of any unincorporated adapters which are hard to detect and known to cause index hopping.

This could also be...
Forum: Illumina/Solexa 10-23-2019, 05:01 PM
Replies: 6
Views: 1,960
Posted By jdk787
It's likely that you are just sequencing off of...

It's likely that you are just sequencing off of the end of the library, since your read length is longer than most of your inserts with adapter on the end.

Why use 300 cycles when you largest...
Forum: Illumina/Solexa 04-27-2019, 02:52 PM
Replies: 3
Views: 2,012
Posted By jdk787
This true of libraries with Y shaped adapters...

This true of libraries with Y shaped adapters prior to PCR, but after PCR won't there also be strands that contain the complements to the original adapter sequences? So for a double stranded library...
Forum: Illumina/Solexa 04-10-2019, 05:49 PM
Replies: 3
Views: 1,627
Posted By jdk787
Yes, I have actually designed custom dual index...

Yes, I have actually designed custom dual index primers that work on our MiSeq (NovaSeq style) but not on our MiniSeq (HiSeqX style).



I would first look at your I5 oligo sequence and compare...
Forum: Illumina/Solexa 04-10-2019, 05:05 PM
Replies: 3
Views: 1,627
Posted By jdk787
The I5 index chemistry for the HiSeqX is...

The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.
...
Forum: Sample Prep / Library Generation 08-27-2018, 08:41 PM
Replies: 12
Views: 80,567
Posted By jdk787
www.kumc.edu/Documents/gsf/nM%20Conversion%20Calcu...

www.kumc.edu/Documents/gsf/nM%20Conversion%20Calculator.xlsx

https://support.illumina.com/bulletins/2016/11/converting-ngl-to-nm-when-calculating-dsdna-library-concentration-.html
Forum: Epigenetics 05-18-2018, 04:05 PM
Replies: 17
Views: 12,648
Posted By jdk787
@Castrolsc The digestion profile will vary by...

@Castrolsc The digestion profile will vary by sample type, but it looks like the digestion for your Sperm DNA worked fine. There is material in the range you need for library generation, and the...
Forum: Metagenomics 04-15-2018, 10:49 AM
Replies: 13
Views: 7,677
Posted By jdk787
It looks like your Q scores have a big drop at...

It looks like your Q scores have a big drop at ~80bp which indicates that you have a lot of smaller than expected library fragments. Since you are sequencing v3-v4 libraries I would guess this is due...
Forum: Illumina/Solexa 02-17-2018, 07:21 AM
Replies: 5
Views: 1,842
Posted By jdk787
This has happened to me with the MiSeq and it was...

This has happened to me with the MiSeq and it was a problem with the sample sheet that kept the run from demuxing. If this is what happened then the error log will tell you which lines of your sheet...
Forum: RNA Sequencing 09-27-2017, 07:18 AM
Replies: 7
Views: 1,706
Posted By jdk787
Take a look at this thread, it addresses the same...

Take a look at this thread, it addresses the same issue you are having.
http://seqanswers.com/forums/showthread.php?t=70088

After trimming the adapters on the MiSeq you are left with short...
Forum: Illumina/Solexa 09-25-2017, 12:41 PM
Replies: 3
Views: 1,861
Posted By jdk787
Hello Svitlana I looked at this sequence from...

Hello Svitlana
I looked at this sequence from your other post http://seqanswers.com/forums/showthread.php?t=78247 and the reverse complement matches TruSeq Process controls CTA-150bp, CTA-450bp,...
Forum: Illumina/Solexa 09-22-2017, 06:22 PM
Replies: 11
Views: 1,709
Posted By jdk787
Looks like the reverse complement of #3...

Looks like the reverse complement of #3 (GCGGCCGCGATATCCTGCAGATGCATCCAGTACTAGTATGGCCC) matches the last 55 base of TruSeq process controls CTA-150bp, CTA-450bp, CTA-550bp, and CTA-850bp
Forum: Bioinformatics 09-19-2017, 08:44 AM
Replies: 5
Views: 1,849
Posted By jdk787
It looks like the index sequences in your sample...

It looks like the index sequences in your sample sheet are in the wrong orientation. The demux report shows that the reverse complement of your sample sheet index sequences is what was found in your...
Forum: Sample Prep / Library Generation 08-12-2017, 09:12 AM
Replies: 11
Views: 4,476
Posted By jdk787
Those peaks are most likely leftover primers,...

Those peaks are most likely leftover primers, which should not be a problem since they won't cluster.
Forum: Illumina/Solexa 05-10-2017, 08:19 PM
Replies: 2
Views: 2,839
Posted By jdk787
A single index run will read the I7 index

A single index run will read the I7 index
Forum: Illumina/Solexa 04-20-2017, 12:45 PM
Replies: 5
Views: 1,659
Posted By jdk787
I don't have any hands on experience with the...

I don't have any hands on experience with the NextSeq, but there seems to be a tendency for NextSeq data to have more polyG sequences in R2 than in R1. Possibly due to some inefficiency in the Read 2...
Forum: General 03-27-2017, 08:59 PM
Replies: 2
Views: 1,385
Posted By jdk787
https://www.sprpages.nl/kunena/new-forum

https://www.sprpages.nl/kunena/new-forum
Forum: Bioinformatics 02-10-2017, 08:11 PM
Replies: 4
Views: 3,990
Posted By jdk787
It looks like you are trimming paired end files...

It looks like you are trimming paired end files in single end mode.
Try switching to paired end mode when trimming.

From Cutadapt User Guide
cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o...
Forum: General 02-04-2017, 01:20 PM
Replies: 4
Views: 2,972
Posted By jdk787
Have you tried using Galaxy? ...

Have you tried using Galaxy?
https://usegalaxy.org/
Forum: Illumina/Solexa 02-01-2017, 08:12 PM
Replies: 14
Views: 4,525
Posted By jdk787
If you mean that your library inserts will...

If you mean that your library inserts will contain inline barcodes (I assume at the beginning of your R1 and R2 read) that you will use to demultiplex, then yes you can omit the index read.
Showing results 1 to 25 of 71
Page 1 of 3 1 23

 


All times are GMT -8. The time now is 02:55 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO