SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 324
Search took 0.04 seconds.
Search: Posts Made By: Chipper
Forum: Bioinformatics 10-25-2016, 02:37 AM
Replies: 16
Views: 1,111
Posted By Chipper
Samtools tview Always look at the reads, not...

Samtools tview

Always look at the reads, not just the stats. The number of unique fragments is what matters, not the duplication rate. 80% duplicates would be useless if you sequenced 2 M reads,...
Forum: SOLiD 07-05-2016, 06:55 AM
Replies: 15
Views: 4,185
Posted By Chipper
The quoted error rate (<0.1%) must be after...

The quoted error rate (<0.1%) must be after reference-based correction. The problem with SOLiD was the high raw error rate of the ligation based chemistry (compared to Illumina) and the short read...
Forum: SOLiD 05-23-2016, 08:21 AM
Replies: 15
Views: 4,185
Posted By Chipper
No. Besides that it is obsolete it gave far too...

No. Besides that it is obsolete it gave far too short reads.
Forum: Sample Prep / Library Generation 05-19-2016, 12:28 PM
Replies: 6
Views: 645
Posted By Chipper
MNase cuts in between nucleosomes, I did not know...

MNase cuts in between nucleosomes, I did not know it was possible on naked dna. Maybe try NEB fragmentase?
Forum: Sample Prep / Library Generation 05-19-2016, 11:25 AM
Replies: 6
Views: 645
Posted By Chipper
Are you digesting chromatin or purified DNA?

Are you digesting chromatin or purified DNA?
Forum: RNA Sequencing 04-27-2016, 02:55 AM
Replies: 15
Views: 1,703
Posted By Chipper
My guess would be that you have more rDNA in the...

My guess would be that you have more rDNA in the second experiment. The 45S rDNA sequence is not included in hg19.
Forum: SOLiD 04-09-2016, 04:36 AM
Replies: 13
Views: 1,926
Posted By Chipper
solid reads had a high raw error rate. bowtie...

solid reads had a high raw error rate. bowtie with default settings is not ideal for 75 bp reads so 13 % seems about right. bfast will do a better job but start with trimmed reads and change...
Forum: Bioinformatics 04-05-2016, 11:07 PM
Replies: 20
Views: 5,336
Posted By Chipper
I don't remember exactly how many mismatches...

I don't remember exactly how many mismatches bowtie1 tolerates, it should work but you may have to change some settings if you have lots of mismatches at the end, hence my suggestion to try mapping...
Forum: Bioinformatics 04-05-2016, 09:01 AM
Replies: 20
Views: 5,336
Posted By Chipper
Try with --trim3 50 in case the 3' ends of your...

Try with --trim3 50 in case the 3' ends of your reads are of low quality or contains N:s. Bowtie1 seems like an odd choice for PE75 reads but it should give you some alignments...
Forum: Epigenetics 12-28-2015, 02:56 AM
Replies: 6
Views: 1,642
Posted By Chipper
What is your definition of multimappers?

What is your definition of multimappers?
Forum: SOLiD 12-19-2015, 01:33 AM
Replies: 1
Views: 2,134
Posted By Chipper
Try with a longer index, I think the recommended...

Try with a longer index, I think the recommended were between 12-14 long? 5 bases with no open positions does not make much sense for human. Masking strategies are described in the...
Forum: Oxford Nanopore 10-28-2015, 07:00 AM
Replies: 13
Views: 2,781
Posted By Chipper
No, the 2d read would be ATGAGGATCAGCCGCAAGCGGAA...

No, the 2d read would be ATGAGGATCAGCCGCAAGCGGAA (or as close as it gets given the error rate). In this case ATGAGGATCAGCCGCAAGCGGAA would also be given as the forward (template) read, and ...
Forum: Pacific Biosciences 10-07-2015, 09:18 AM
Replies: 62
Views: 16,512
Posted By Chipper
RCA and LAMP is certainly possible today. Maybe...

RCA and LAMP is certainly possible today. Maybe not practical, or needed if accuracy goes up.
Forum: Epigenetics 09-05-2015, 02:53 PM
Replies: 2
Views: 1,068
Posted By Chipper
Yes, it is common. Just look at some ENCODE...

Yes, it is common. Just look at some ENCODE datasets. Sort of like FAIRE. You should expect your ChIP peaks to be much higher though. Would guess PAF1 has a few good sites at ~- 500 bp that averages...
Forum: Bioinformatics 06-20-2015, 01:45 PM
Replies: 14
Views: 4,724
Posted By Chipper
biovenn venny 2.0

biovenn

venny 2.0
Forum: De novo discovery 06-08-2015, 11:36 AM
Replies: 5
Views: 2,833
Posted By Chipper
I do not know how the flow cytometry measurment...

I do not know how the flow cytometry measurment works but 800=4*200, are you sure your plant is not tetraploid?
Forum: Sample Prep / Library Generation 06-03-2015, 01:16 PM
Replies: 1
Views: 498
Posted By Chipper
Why not use dynabeads directly? They...

Why not use dynabeads directly? They (Invitrogen/Ambion/Life/thermo or whatever they are called now) have a mRNA direct kit that is much cheaper than buying beads only.
Forum: Sample Prep / Library Generation 05-26-2015, 09:38 PM
Replies: 4
Views: 743
Posted By Chipper
No, you can do end repair after the 2nd strand...

No, you can do end repair after the 2nd strand reaction without purification.
Forum: Bioinformatics 05-07-2015, 01:41 PM
Replies: 16
Views: 2,931
Posted By Chipper
They modified the settings to make sure lots of...

They modified the settings to make sure lots of valid alignments are not reported, just like (bowtie -m 1 -v 3). Then they use a better aligner and find more usable reads. Some interesting things...
Forum: Bioinformatics 04-27-2015, 02:04 AM
Replies: 16
Views: 2,931
Posted By Chipper
Just use BWA and filter on mapping quality (e.g...

Just use BWA and filter on mapping quality (e.g -q 20) to get uniquely mapped reads if you don't understand the bowtie options.
-m 1 will suppress even perfect matches if there are any other...
Forum: Bioinformatics 04-24-2015, 11:20 AM
Replies: 16
Views: 2,931
Posted By Chipper
Reading the manual is also a good start: -m...

Reading the manual is also a good start:

-m <int>
Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. Reportable alignments are those that...
Forum: Bioinformatics 04-24-2015, 06:41 AM
Replies: 16
Views: 2,931
Posted By Chipper
Adapter dimers should be found by FASTQC so the...

Adapter dimers should be found by FASTQC so the only things I can think of then is if you have N:s in the reads or very low quality ends.
Forum: Bioinformatics 04-24-2015, 06:22 AM
Replies: 16
Views: 2,931
Posted By Chipper
My guess is you didn't trim your reads and are...

My guess is you didn't trim your reads and are reading into the adaptor. Try bwa mem if you have 100 or 125 bp reads.
Forum: Ion Torrent 04-21-2015, 08:25 AM
Replies: 121
Views: 95,620
Posted By Chipper
Wait for the minION.

Wait for the minION.
Forum: Sample Prep / Library Generation 04-17-2015, 09:37 AM
Replies: 3
Views: 775
Posted By Chipper
I have sequenced some libraries that were > 1 y...

I have sequenced some libraries that were > 1 y old without problem but of course it is no guarantee. But in this case it does not make sense to me to take one replicate to 15 M reads instead of 3x5M.
Showing results 1 to 25 of 324

 


All times are GMT -8. The time now is 01:01 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO