SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 20 1 2311 Last »
Showing results 1 to 25 of 500
Search took 0.04 seconds. Search: Posts Made By: nucacidhunter
Forum: Sample Prep / Library Generation 10-06-2020, 05:39 PM
Replies: 3
Views: 1,053
Posted By nucacidhunter
If you add a PCR handle to 5’ end of probe and...

If you add a PCR handle to 5’ end of probe and then amplify captured target with P5 or P7 primer and the handle primer followed by nested primer containing the other adapter sequences, there will be...
Forum: Illumina/Solexa 10-06-2020, 04:03 AM
Replies: 3
Views: 1,046
Posted By nucacidhunter
There is no drawbacks but pooling 12 libraries in...

There is no drawbacks but pooling 12 libraries in one lane of S4 flow cell will output around 200M reads/library. If you are aiming for 30M reads/libray then SP flow cell (350-400M reads) will be...
Forum: Sample Prep / Library Generation 10-05-2020, 04:19 PM
Replies: 3
Views: 1,053
Posted By nucacidhunter
It would be more cost effective to add adapter...

It would be more cost effective to add adapter sequences to the nested primer for sequencing on cheapest Illumina flow cell.
Forum: Illumina/Solexa 10-05-2020, 04:10 PM
Replies: 3
Views: 1,046
Posted By nucacidhunter
There is no limit on number of libraries (up to...

There is no limit on number of libraries (up to 384 is supported by Illumina) for pooling except that they should have unique index for post-sequencing demultiplexing.

One lane of S4 flow cell...
Forum: Sample Prep / Library Generation 09-16-2020, 01:58 AM
Replies: 5
Views: 1,754
Posted By nucacidhunter
Any of following are compatible with cell(s)...

Any of following are compatible with cell(s) input with no RNA extraction:

SMART-Seq v4 3’ DE Kit (requires less sequencing)
SMART-Seq® v4 PLUS Kit
NEBNext Single Cell/Low Input RNA Library Prep...
Forum: Bioinformatics 08-21-2020, 08:51 PM
Replies: 2
Views: 968
Posted By nucacidhunter
There is no technical constraint on the length of...

There is no technical constraint on the length of Illumina paired-end reads apart from R1 which should be 25 cycles. In some applications using asymmetric read length is more cost effective. For...
Forum: Sample Prep / Library Generation 04-17-2020, 01:23 AM
Replies: 6
Views: 1,931
Posted By nucacidhunter
Illumina kit is gold standard in this application...

Illumina kit is gold standard in this application if RNA quantity is not limiting. On the other hand performance of Qiagen kit varies and I would suggest to trial it before committing to use it.
Forum: Sample Prep / Library Generation 03-22-2020, 03:45 AM
Replies: 12
Views: 3,925
Posted By nucacidhunter
High variability of concentration could be one...

High variability of concentration could be one reason.

To reduce variability:
1- Quantify 1st PCR amplicons and use the same mass for indexing PCR. This will reduce gel invisible artefacts.

2-...
Forum: Illumina/Solexa 11-06-2019, 02:30 PM
Replies: 18
Views: 2,829
Posted By nucacidhunter
Run stats seems within specs for the library type...

Run stats seems within specs for the library type although they seem to be more cautious. To increase output safely following can be done:
1- Increasing cluster density to around 800k/mm2
2-...
Forum: Illumina/Solexa 11-05-2019, 02:55 AM
Replies: 18
Views: 2,829
Posted By nucacidhunter
More info for following would be useful: 1- Are...

More info for following would be useful:
1- Are the libraries 6S V regions and overall prep workflow
2- cluster density
3- How many libraries are multiplexed
4- Read output
Forum: Illumina/Solexa 10-29-2019, 04:22 AM
Replies: 7
Views: 3,561
Posted By nucacidhunter
It should be TruSeq as FastQC would indicate. I...

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA


Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Forum: Illumina/Solexa 10-29-2019, 12:57 AM
Replies: 7
Views: 3,561
Posted By nucacidhunter
The library is sequenced on Illumina system so...

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.
Forum: Illumina/Solexa 10-12-2019, 06:55 PM
Replies: 2
Views: 1,512
Posted By nucacidhunter
Cluster density is above specification but final...

Cluster density is above specification but final results for PF and Q30 looks good. Those thumbnails are specific for selected cycle and base and if you select different base at the same cycle it...
Forum: RNA Sequencing 09-17-2019, 07:56 PM
Replies: 2
Views: 3,376
Posted By nucacidhunter
RiboFree total RNA-seq library prep from Zymo...

RiboFree total RNA-seq library prep from Zymo Research looks good on paper and does not require species specific depletion step but I have not tried yet:
...
Forum: Sample Prep / Library Generation 09-14-2019, 02:24 AM
Replies: 20
Views: 9,445
Posted By nucacidhunter
Regardless of size distribution, library does not...

Regardless of size distribution, library does not seem to have typical periodicity expected in ATAC-seq libraries indicating that there was ambient DNA in nuclei stock or nuclei disintegrated during...
Forum: Ion Torrent 08-02-2019, 11:52 PM
Replies: 19
Views: 9,991
Posted By nucacidhunter
Following is the link to some OZ sequencing...

Following is the link to some OZ sequencing service providers:

http://www.agrf.org.au/contact-us

https://www.ramaciotti.unsw.edu.au/

http://dna.med.monash.edu.au/

I am sure they all will...
Forum: Ion Torrent 08-02-2019, 06:38 PM
Replies: 19
Views: 9,991
Posted By nucacidhunter
There are several companies in OZ that will...

There are several companies in OZ that will sequence your own prepared libraries. You can PM me if you one a list.
Forum: Illumina/Solexa 07-30-2019, 03:32 AM
Replies: 2
Views: 1,220
Posted By nucacidhunter
You can use ssDNA library prep method or a kit...

You can use ssDNA library prep method or a kit such as ACCEL-NGS 1S (or
1S Plus) DNA LIBRARY kit.
Forum: Sample Prep / Library Generation 05-25-2019, 06:48 PM
Replies: 1
Views: 1,081
Posted By nucacidhunter
I would suggest to do a reaction according to...

I would suggest to do a reaction according to standard protocol from start to end and check the resulting library. Tagmented DNA will not migrate according to size becuase:
1- transposon will be...
Forum: Sample Prep / Library Generation 05-23-2019, 08:25 PM
Replies: 4
Views: 1,924
Posted By nucacidhunter
plexWell 96 or 384 could fit your library prep....

plexWell 96 or 384 could fit your library prep. It seems to be cheap and also quick.

https://seqwell.com/product/pw96/
Forum: Illumina/Solexa 05-05-2019, 04:17 PM
Replies: 12
Views: 4,807
Posted By nucacidhunter
Any non-hot start polymerase will do the gap...

Any non-hot start polymerase will do the gap filling.
Forum: Sample Prep / Library Generation 04-06-2019, 12:09 AM
Replies: 10
Views: 2,062
Posted By nucacidhunter
Using other reverse transcriptase with strand...

Using other reverse transcriptase with strand switching activity (SMARTScribe, Maxima H Minus) might give better results. There are some threads in this site as well under single cell RNA-Seq...
Forum: Sample Prep / Library Generation 04-05-2019, 11:58 PM
Replies: 3
Views: 882
Posted By nucacidhunter
A general approach is to prime RT reaction with a...

A general approach is to prime RT reaction with a random sequences (6-8nt) followed with a defined 5' overhang and then size select the cDNA. Implementing this will depend on downstream application.
Forum: Sample Prep / Library Generation 04-05-2019, 11:45 PM
Replies: 1
Views: 1,049
Posted By nucacidhunter
If a library is prepared and includes a PCR step...

If a library is prepared and includes a PCR step it should sequence well regardless of input DNA quality. Following can be useful:

1- Treating input DNA with NEB FFPE repair reagents to fix some...
Forum: Illumina/Solexa 04-05-2019, 02:56 AM
Replies: 1
Views: 779
Posted By nucacidhunter
Generally smaller inserts would result in more...

Generally smaller inserts would result in more uniform coverage of genes so for counting applications short inserts are preferred and can be sequenced only 70 cycles. For other applications such as...
Showing results 1 to 25 of 500
Page 1 of 20 1 2311 Last »

 


All times are GMT -8. The time now is 06:19 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO