Forum: Bioinformatics
11-08-2017, 06:22 AM
|
|
Replies: 0
Views: 1,233
|
|
Forum: Bioinformatics
04-02-2014, 06:52 AM
|
|
Replies: 1
Views: 1,204
fastq_quality_filter -p 100 or could be less?
Hello everyone,
I am using FASTX-toolkit to filter my data (small RNA fraction for miRNA analyses) according to quality.
I use the following settings:
fastq_quality_filter -v -q 17 -p 100 -Q 33
...
|
|
Forum: Bioinformatics
02-19-2014, 08:52 AM
|
|
Replies: 3
Views: 1,126
|
|
Forum: Bioinformatics
02-19-2014, 07:47 AM
|
|
Replies: 3
Views: 1,126
Is 30000 reads too low for mapping (miRNAs)
Hello community,
I have just received a fastq file of a study i am conducting.
It had an overall poor quality, and after filetering reads according to quality and size (minQV=17, min length=16),...
|
|
Forum: Bioinformatics
11-22-2013, 02:45 AM
|
|
Replies: 2
Views: 1,598
|
|
Forum: Bioinformatics
11-22-2013, 02:41 AM
|
|
Replies: 4
Views: 1,680
if it is usefull, here the complete script to...
if it is usefull, here the complete script to remove the headers ('@') and then count repeated terms in column 3 of the SAM file:
grep -v '@' myfile.out | awk '{print$3}' | sort | uniq -c | sort...
|
|
Forum: Bioinformatics
11-22-2013, 02:28 AM
|
|
Replies: 4
Views: 1,680
thanks, the grep function was very usufull to...
thanks, the grep function was very usufull to remove the headers.
After doing that, i did a count ot he repited elements on column 3.
cat myfile-noheaders.out | awk '{print$3}' | sort | uniq -c |...
|
|
Forum: Bioinformatics
11-21-2013, 10:35 AM
|
|
Replies: 4
Views: 1,680
script suggestion (SAM file)
Hi everyone!
In this attached example, i would like to know how many times the element
"bta-miR-191" and "bta-miR-10" in the header of a SAM file is repeated in the rest of
the document (in this...
|
|
Forum: Bioinformatics
11-21-2013, 07:16 AM
|
|
Replies: 2
Views: 1,598
I did the following, as a test:
first, i use...
I did the following, as a test:
first, i use the above metioned sequences (identical as you can see)
>bta-let-7b MIMAT0004331
UGAGGUAGUAGGUUGUGUGGUU
>dummy
UGAGGUAGUAGGUUGUGUGGUU
gmapper-ls...
|
|
Forum: Bioinformatics
11-21-2013, 05:55 AM
|
|
Replies: 2
Views: 1,598
puzzle with gmapper -M mirna (shrimp)
Hi everyone,
i am mapping short reads from ion torrent PGM. Reads are QV~20 and 16-155 length.
In FastQC appears this as the highest represented read:
TGAGGTAGTAGGTTGTGTGGTT 19528counts
...
|
|
Forum: Bioinformatics
11-19-2013, 01:53 PM
|
|
Replies: 6
Views: 3,028
|
|
Forum: Bioinformatics
11-19-2013, 12:47 PM
|
|
Replies: 6
Views: 3,028
|
|
Forum: Bioinformatics
11-19-2013, 12:25 PM
|
|
Replies: 6
Views: 3,028
|
|
Forum: Bioinformatics
11-19-2013, 11:44 AM
|
|
Replies: 6
Views: 3,028
min length and max length with fastx tookit
Hello everyone,
i was wondering if there's a way to filter fastq reads based on minimun and maximun length. Plus trimming at minimun quality value.
this is the closest i've came out with:
...
|
|
Forum: Bioinformatics
11-19-2013, 02:11 AM
|
|
Replies: 8
Views: 4,953
|
|
Forum: Ion Torrent
11-19-2013, 02:04 AM
|
|
Replies: 2
Views: 3,408
P1 and A adater trimming and mapping
Hi eveyone,
i have a few very basic questions that are buging me:
- The emulsion PCR performed to create a template results in amplicons attached to a bed, which in turn goes to the pico-well and...
|
|
Forum: Bioinformatics
11-19-2013, 01:36 AM
|
|
Replies: 8
Views: 4,953
Thank you very much to you all for the quick...
Thank you very much to you all for the quick responses, it's now clearer.
If I understood correctly, the analyses performed by FastQC are modeled for genomic DNA, where the sequenced fragments...
|
|
Forum: Bioinformatics
11-18-2013, 07:38 AM
|
|
Replies: 8
Views: 4,953
FastQC Overrepresented Sequences problem
Hi guys,
i am very new at NGS data procesing.
First, a small introduction to my current situation:
- Samples were the small RNA fraction (<200 nt, MIRVANA MIRNA ISOLATION kit).
- Library and...
|
|
Forum: Introductions
11-18-2013, 07:13 AM
|
|
Replies: 0
Views: 893
Hi guys!
Hi everyone, i have recently started working with NGS data and it's something i am not so familiar with. So i will ray to share the few things i know with you, and hopefully you'll do the same.
...
|
|
Forum: Introductions
07-08-2013, 06:19 AM
|
|
Replies: 0
Views: 628
Hi everyone
Hi everyone, I am doing my PhD and I am starting with deep sequencing analysis using PGM ion torrent. I joined this community to get help for my analysis and maybe later help other with theirs.
...
|
