SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 51
Search took 0.00 seconds.
Search: Posts Made By: Zam
Forum: Bioinformatics 07-18-2013, 11:03 AM
Replies: 7
Views: 5,085
Posted By Zam
Hi Anna I don't think there is such a manual,...

Hi Anna
I don't think there is such a manual, but the right people to ask are Ricardo and Richard at TGAC:
Ricardo.Ramirez-Gonzalez@tgac.ac.uk
Richard.Leggett@tgac.ac.uk
Email them directly, and...
Forum: Bioinformatics 02-19-2013, 11:14 PM
Replies: 15
Views: 5,028
Posted By Zam
Is that 10000 variants in tumour but not normal...

Is that 10000 variants in tumour but not normal per sample then?
Forum: Bioinformatics 02-19-2013, 10:56 PM
Replies: 15
Views: 5,028
Posted By Zam
Hi there. I didn't realise you were talking about...

Hi there. I didn't realise you were talking about cancer samples.
1. the thing that bothers you seems to me not to be the most difficult problem you face. 10,000 variants per sample does not seem...
Forum: Bioinformatics 02-18-2013, 12:33 AM
Replies: 15
Views: 5,028
Posted By Zam
Depends on your input data (what species, do you...

Depends on your input data (what species, do you have data from multiple samples).
If these things are genuine SVs segregating in the population, then you should see them in many samples, and the...
Forum: Genomic Resequencing 02-12-2013, 08:58 AM
Replies: 8
Views: 2,611
Posted By Zam
Or use de novo assembly to directly call variants...

Or use de novo assembly to directly call variants between your samples ignoring the reference, as was done here in S.aureus, also in a longitudinal study

Evolutionary dynamics of Staphylococcus...
Forum: Illumina/Solexa 12-29-2012, 05:28 AM
Replies: 9
Views: 2,858
Posted By Zam
Yes, it can call biallelic sites in polyploids....

Yes, it can call biallelic sites in polyploids. The genotyping models only handle haploid and diploid, so you will have to do discovery only, but the VCF will report coverage on both alleles, so you...
Forum: Bioinformatics 12-19-2012, 04:04 PM
Replies: 12
Views: 9,981
Posted By Zam
This paper (apologies for self-publicity) might...

This paper (apologies for self-publicity) might be of interest to you:

High-throughput microbial population genomics using the Cortex variation assembler. Z Iqbal, I Turner, G McVean,...
Forum: Illumina/Solexa 12-19-2012, 03:49 PM
Replies: 9
Views: 2,858
Posted By Zam
Cortex is designed to call variants between...

Cortex is designed to call variants between samples, without a reference.

Papers:
1. De novo assembly and genotyping of variants using colored de Bruijn graphs.
Z Iqbal, M Caccamo, I Turner, P...
Forum: De novo discovery 09-21-2012, 02:34 AM
Replies: 15
Views: 5,390
Posted By Zam
It's fine. I have more questions - shall we take...

It's fine. I have more questions - shall we take it offline? I'm zam AT well.ox.ac.uk
Forum: De novo discovery 09-21-2012, 02:26 AM
Replies: 15
Views: 5,390
Posted By Zam
Hi there- when you say one of the samples is...

Hi there- when you say one of the samples is parental, does that mean you have two parents and 2 F1 samples, and you have sequenced one parent and both progeny?
Zam
Forum: De novo discovery 09-21-2012, 02:06 AM
Replies: 15
Views: 5,390
Posted By Zam
Yes, and to explain that in more detail: ...

Yes, and to explain that in more detail:
Rururura:

1.If you have one diploid sample you can de novo discover variants using Cortex, and then use your contigs/scaffolds to assign them coordinates....
Forum: De novo discovery 09-21-2012, 01:49 AM
Replies: 15
Views: 5,390
Posted By Zam
Hi Rururara Are you working on the same project...

Hi Rururara
Are you working on the same project as Fernando or a different one? If different, how many samples are you trying to discover SNPs in, and what are their depths od coverage and with what...
Forum: Bioinformatics 06-27-2012, 11:43 PM
Replies: 6
Views: 2,081
Posted By Zam
one more for the long list: ...

one more for the long list:

http://seqanswers.com/forums/showthread.php?t=16695
Forum: Bioinformatics 06-20-2012, 12:17 AM
Replies: 7
Views: 5,085
Posted By Zam
Sounds good - why don't we take this offline -...

Sounds good - why don't we take this offline - I'll email you.
Zam
Forum: Bioinformatics 06-19-2012, 09:52 PM
Replies: 7
Views: 5,085
Posted By Zam
Hi Hideo >Some organism like Leishmania have...

Hi Hideo

>Some organism like Leishmania have extensive aneuploidy where copy number of 36 >chromosomes is highly variable. Do I need particular parameter tuning in CORTEX for >such an organism?
...
Forum: De novo discovery 06-15-2012, 10:18 AM
Replies: 9
Views: 2,667
Posted By Zam
Again - Cortex will do it cheers Zam

Again - Cortex will do it
cheers
Zam
Forum: De novo discovery 06-15-2012, 12:18 AM
Replies: 9
Views: 2,667
Posted By Zam
There is a (our) published tool precisely for...

There is a (our) published tool precisely for detecting variants from sequence data without using a reference, you could try that:

Z Iqbal*, M Caccamo*, I Turner, P Flicek, G McVean.
De novo...
Forum: Bioinformatics 03-18-2012, 02:45 AM
Replies: 12
Views: 4,553
Posted By Zam
I should have said explicitly. There is a...

I should have said explicitly. There is a trade-off. Cortex assembles full alleles, giving you flank, allele1, allele2, flank, rather than just breakpoints. That's the advantage over other SV callers...
Forum: Bioinformatics 03-18-2012, 02:35 AM
Replies: 12
Views: 4,553
Posted By Zam
Speaking of assembly of SVs, you could also try...

Speaking of assembly of SVs, you could also try Cortex (sorry for the plug, I am an author)
http://www.nature.com/ng/journal/v44/n2/full/ng.1028.html...
Forum: Bioinformatics 03-13-2012, 01:56 AM
Replies: 13
Views: 6,086
Posted By Zam
Just a comment for odoyle81 about using Cortex -...

Just a comment for odoyle81 about using Cortex - you should not need to pre-quality filter the reads for Cortex (unless you have massive massive coverage, in which case it will do no harm I guess)....
Forum: De novo discovery 03-07-2012, 01:05 AM
Replies: 17
Views: 11,032
Posted By Zam
Hi there, To answer your questions about Cortex...

Hi there,
To answer your questions about Cortex
1. cortex will only give you chr/pos coordinates if you give it a reference. It does not attempt to build a whole genome assembly.
2. Cortex will...
Forum: De novo discovery 03-06-2012, 04:43 AM
Replies: 17
Views: 11,032
Posted By Zam
Cortex will produce SNP+other variant calls for...

Cortex will produce SNP+other variant calls for you, and will genotype your samples. It will also produce flanking sequence for your calls, which should help you set up your Sequenom. That will all...
Forum: General 03-04-2012, 11:40 PM
Replies: 9
Views: 33,928
Posted By Zam
Hi xlzhang "fst_r:GT fst_f:G" and "lst_r:A...

Hi xlzhang

"fst_r:GT fst_f:G" and "lst_r:A lst_f:AT"

This describes the edges going in/out of the contig at the first/last nodes.
The first node has G and T edges going out in the reverse...
Forum: General 03-04-2012, 11:34 AM
Replies: 9
Views: 33,928
Posted By Zam
Hi there 1. Kmers are just words (chunks of...

Hi there

1. Kmers are just words (chunks of sequence) of length k.
2. The current version of Cortex contains some unnecessary stuff in the output.
This text
lst_kmer:ATATTTTCTTACATGTTCCAAGGGT
...
Forum: Bioinformatics 02-28-2012, 07:37 AM
Replies: 4
Views: 1,932
Posted By Zam
PS - if you let me know how many strains and what...

PS - if you let me know how many strains and what kind of coverage, I can tell you how hard this is. But roughly speaking, I would expect you to be able to get results within a day
Showing results 1 to 25 of 51

 


All times are GMT -8. The time now is 01:09 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO