SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 52
Search took 0.00 seconds.
Search: Posts Made By: empyrean
Forum: Bioinformatics 03-23-2014, 11:45 AM
Replies: 0
Views: 1,556
Posted By empyrean
Extract mapped information from bam files

Hello,

I have 3 bam files that i wanted to compare against each other. For example i have reference file with 10,000 sequences. I have paired end reads sequenced for 3 different samples.

1)...
Forum: Bioinformatics 02-04-2014, 08:20 AM
Replies: 3
Views: 2,181
Posted By empyrean
Hi.. i have around million genome coordinates and...

Hi.. i have around million genome coordinates and i am not sure whether tophat can handle that many data points. Also, the genome coordinates vary from 20bp to 10kb regions.
Forum: Bioinformatics 02-03-2014, 12:18 PM
Replies: 3
Views: 2,181
Posted By empyrean
normalizing multicov output

Hi..

i used multicov to get read counts for specific genomic regions from different samples. Now, i would like to get expression values for those samples by normalizing the data. Can anyone...
Forum: Bioinformatics 07-14-2013, 08:09 PM
Replies: 6
Views: 3,869
Posted By empyrean
to add 25 bp sequence, you can use the following...

to add 25 bp sequence, you can use the following command

awk 'NR % 2 {print} !(NR % 2) {print $0"GGGGGGGGGGGGGGGGGGGGGGGGG"}' mature.fa
Forum: Bioinformatics 04-25-2013, 08:05 AM
Replies: 0
Views: 941
Posted By empyrean
Archiving/documentation help

Just a quick question.
What software do you use or how do you archive NGS data analysis projects? What meta information regarding to sequencing run and analysis do you store ? Any suggestions on...
Forum: Bioinformatics 03-20-2013, 11:24 AM
Replies: 7
Views: 3,535
Posted By empyrean
thank you for your advices, thats what minion...

thank you for your advices, thats what minion fount from my data as well when i searched for adapter.
Forum: Bioinformatics 02-27-2013, 07:47 PM
Replies: 7
Views: 3,535
Posted By empyrean
thank you for the reply.. i did look for that...

thank you for the reply..
i did look for that using 5' adapter and it did not help either..
Forum: Bioinformatics 02-27-2013, 01:37 PM
Replies: 7
Views: 3,535
Posted By empyrean
Small rna pipeline

hi..

I am working on small rna sequencing which was sequenced through illumina hiseq. the read length i got was 30bp. When i removed 3' adapter, i see that 90% of the reads are having 30bp. I...
Forum: Bioinformatics 12-06-2012, 07:58 PM
Replies: 3
Views: 3,286
Posted By empyrean
250bp paired end Miseq reads alignment

Hello all

Recently we upgraded our miseq and got 2*250 run data. Does anyone have experience in aligning this sort of data? I have been using bwa till now for previous runs when it produced 2*150....
Forum: Bioinformatics 11-28-2012, 06:06 PM
Replies: 28
Views: 15,481
Posted By empyrean
i dont know if you are still looking. but this...

i dont know if you are still looking. but this simple code should do the counts. i got this from this forum only

awk 'NR%4==2' input.fastq|sort |uniq -c|awk '{print $1"\t"$2}'
Forum: Bioinformatics 08-31-2012, 07:09 AM
Replies: 1
Views: 2,052
Posted By empyrean
Split fastq file with renaming reads

Hi

I am trying to split fastq file to one read per file seperately and rename the read name. For example


@HBGAIY001A
TGTCTCAACTAATTTAGCCGCAGACCAAGTCTCTGCTACCGT
+HBGAIY001A...
Forum: Bioinformatics 08-27-2012, 02:12 PM
Replies: 3
Views: 2,032
Posted By empyrean
Converting 454 reads to illumina reads

Hello

i have a pipeline which works with illumina reads. When i convert the 454 reads in to fastq format and give it as input, the pipeline is not working. The average length of the sequence is...
Forum: Bioinformatics 08-27-2012, 01:32 PM
Replies: 4
Views: 2,465
Posted By empyrean
i have a script which works on ace file. Now i...

i have a script which works on ace file. Now i got the bam file and i need to convert it to .ace file
Forum: Bioinformatics 08-27-2012, 09:23 AM
Replies: 4
Views: 2,465
Posted By empyrean
Sam / Bam to Ace conversion

Does anyone know how to convert from sam or bam to ace file? i am seeing lot of threads for converting ace to bam but not bam to ace..
Forum: Bioinformatics 08-23-2012, 07:44 PM
Replies: 0
Views: 2,241
Posted By empyrean
Haplotype caller

hi..

I have 454 Amplicon sequencing data for a tetraploid potato crop. we have sequenced few genes of interest from several different genotypes. My aim is to seperate genotypes and sub genomes...
Forum: Bioinformatics 07-02-2012, 10:46 AM
Replies: 4
Views: 3,948
Posted By empyrean
thank you.. its doing exactly as i asked .. but...

thank you.. its doing exactly as i asked .. but looking at the output i realized that i asked my question wrongly.

I guess i should have made my question clear..sorry about that.. So once the read...
Forum: Bioinformatics 06-28-2012, 08:15 AM
Replies: 4
Views: 3,948
Posted By empyrean
Extract base from bam file

I have a bam file and i wanted to extract the following information.

For a read in a bamfile, can i extract the base based on the position? For example, if i say i need the base at 100th position...
Forum: Bioinformatics 06-25-2012, 02:00 PM
Replies: 3
Views: 1,722
Posted By empyrean
thankyou for the reply. jhmc is asking for pcr...

thankyou for the reply.
jhmc is asking for pcr primers as tags. but i dont know the pcr primers. Also i dont see it constructing a haplotype map. all i have is sequencing reads and reference genes...
Forum: Bioinformatics 06-25-2012, 01:34 PM
Replies: 3
Views: 1,722
Posted By empyrean
Haplotype calls from Amplicon Sequencing

Hi.. i have data for two groups.. one group has 10 diffent strains and other group has 5 different strains. 40 genes are selected and primers are designed for these genes. Sequencing is performed on...
Forum: Bioinformatics 06-22-2012, 01:29 PM
Replies: 2
Views: 2,103
Posted By empyrean
i am working on similar problem. did you find any...

i am working on similar problem. did you find any useful software which does this job??
Forum: RNA Sequencing 06-12-2012, 08:16 AM
Replies: 2
Views: 2,344
Posted By empyrean
i performed differential expression by giving 15...

i performed differential expression by giving 15 samples as input to edgeR and it gave me a file name Filename.normalized.FPKM and it has values ranging from 0 to 800,000 . I think its not a fold...
Forum: RNA Sequencing 06-11-2012, 04:33 PM
Replies: 2
Views: 2,344
Posted By empyrean
RNA Seq Analysis with multiple samples

Hi..

I have 5 rna seq samples for one group and 10 samples in another group. For this organism there is no reference transcriptome. I have assembled them using trinity and did assembly again by...
Forum: Bioinformatics 05-22-2012, 07:25 AM
Replies: 8
Views: 2,435
Posted By empyrean
Thanks again.. hoping for some help here !!

Thanks again.. hoping for some help here !!
Forum: Bioinformatics 05-22-2012, 06:52 AM
Replies: 8
Views: 2,435
Posted By empyrean
Thank you for the reply. Actually No because, i...

Thank you for the reply. Actually No because, i need to get the exact base for the read to build such haplotype graph.
Forum: Bioinformatics 05-21-2012, 06:21 PM
Replies: 8
Views: 2,435
Posted By empyrean
Any suggestions / comments?

Any suggestions / comments?
Showing results 1 to 25 of 52

 


All times are GMT -8. The time now is 06:55 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO